Microarray Probes on PGSC0003DMT400066826

Probe IDChipProbe Sequence
CUST_17781_PI426222305 JHI_St_60k_v1 CCTTGCTGCATATATTCTTCCATTGCTCCATGCCTACTTCCAAAAACAAAATCACTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066826

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066826 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G44980.2 +1 3e-130 427 249/412 (60%) SNF2 domain-containing protein / helicase domain-containing protein | chr2:18552343-18556669 REVERSE LENGTH=877

Transcript Sequence (4033 bp)

>PGSC0003DMT400066826 4033 pgsc_dm_v3.4
CACAGTGTTATTAAAAGCGAAAAGCGTAAAAAAGCTCTAAGGTCAGTGGGGGCTTTAAGC
GCAAAGCGCAAATAAAGCGTGGGCTTTAATGAAAAAAGGCGCAAAGGGTGAAAAAATAAA
ATGTGTATGTTTAGTCCAAAACTAATAATTATAAACATGAATGACAAATATATGACCAAA
GAAATTTAATTTTTTTATGATTAAGTGAAATATCAATTGTGTAGTGTCACTTCTTCATAA
GAGACTCATTGAAAAGGAAAAGTTTTTCTTAGAACTTTGATGACGACACTGAAGCGCACA
TAAAGCGAGGCGAAGCGCTCAAGAATCTGCATTAGATGAGAGTTCATTAAGTATCTTTCT
GCGGTTCACAGTGTTATTAAAAGCGAAAAGCGTAAAAAAGCTCTAAGGTCAGTGGGGGCT
TTAAGCGCAAAGCGCAAATAAAGCGTGGGCTTTAATGAAAAAAGGCGCAAAGGGTGAAAA
AATAAAATGTGTATGTTTAGTCCAAAACTAATAATTATAAACATGAATGACAAATATATG
ACCAAAGAAATTTAATTTTTTTATGATTAAGTGAAATATCAATTGTGTAGTGTCACTTCT
TCATAAGAGACTCATTGAAAAGGAAAAGTTTTTCTTAGAACTTTGATGACGACACTGAAG
CGCACATAAAGCAAAGCGAAGCGCTCAACACGTTTTGAGCCTCGCTTTAGGGCTTAAGCG
CGCTTAAAGCGCGCCTTTGATAACACTGGCGGTTCATCATCTCCACTTCATTTTGTCATA
ATATCATGCTTATGTAGCTGTTTTGGCCTTTAAAGGGTGAGAAAAATGCTTTGGACTTGG
AGATCTATTTGTTAGAGCTCAGCTTGTGTCTTCCCTAATACTAACCTGCAGACTCACTTC
CAGGTAATTCAACTACGAAAAGCATGTAGTCATCCTTACCTTTTTGCTGGTATAGAACCG
GAACCATATGAAGAAGGAGAACACCTAGTTCAGGCTAGCGGCAAACTGCTAATATTGGAT
CATCTTCTTCAAAAACTTCATGCTTGTGGACATAGGGTTCTTCTTTTCTCTCAGATGACT
CAAACACTTGATATACTGCAGGATTATCTGGAATTGAGGAAGTATTCTTATGAGCGTCTT
GATGGTTCAATTCGTGCGGAAGAGCGCTTTGCTGCAATCAGGAGCTTTAGTCATAATAGA
TCAAAGTTTGAAGCTGAACAAAATGCAGCATTTGTTTTCTTGATTTCAACAAGAGCTGGT
GGAGTTGGGTTGAATCTTGTGGCTGCTGATACAGTGAGTGACAATTACTGGCCGAACTTT
TATTATCGGATTGGTTTAAGATTATATACTTGGGTTAATCCTTATATTGTACAAGTACTT
TTTTCGAATATATATTGTACAAGTAAGGAGTGTTCATTCATCAACATTTTCTCCTCTTGA
TATATGGAAAGAGGTGATAGAGACACTTGGATCATACGCGAAAGCGAAATTGTAATGCAC
AGGTAGAATATCTAACTGTTCAAGATCAAACTTTAACTGGTTCAATGCTTGATCTCAAAT
TTGTTAAAGAATATTATCTTCATTCATGGATATTGATGCGCTTCTCTTTTCCTAATTGTT
ATCATTGAGACGTTTAGCTCATGAGTTATACCATCAAGGAAAAAACTGCTGATAGCTCAT
ATTTGTTGACAACATGCATCACAGTGATGCCAGTTGCTACCTACTGGATGATAGGTGGAG
CATGTGTTAGTAAGTCATAATTTTTCTGGACCTGGCAATGCTTAATGGTGCAGTTCTTGC
AAGTGATTTGAATAATATACTTTAATTCTTGTCTTAAGTTCGATTTCAATGGCACAAAAT
AGTTATTCCTGTTCCTTTTGGCCACTGCATAGTGGTGTTAGTAACATATTGACCTGTCTT
GTTTTGATTGGACATCCATTTCTTTCATCTCCTTGACAAGTTGTGGTGGTGTAGGTCATA
TTTTACGAGCAAGATTGGAATCCTCAGGTAGACAAGCAGGCCTTGCAGCGTGCTCACCGA
ATTGGTCAAACAAACCACGTGTTATCTATAAATTTAGTCACAGAGCAGTCAGTGGAGGAG
GTCATCATGCGTAGAGCTCAACGGAAGTTACAGCTTAGCCACAACATTATAGGAGATGAT
GTCTTGGATCAGGAAGGGAAAGAGATGGCAGGAGCTGAAGCTGGTGACTTGCGATCTGTT
ATGCTTGGCTTGCATATGCTAGATCCTGCAGAAGTAACCAATGAAGAATCAGATAAATTT
GATAGGAATGAATTGACTGCAATGGCAGAAACAATTATGGCTTTTCGCAATGAAGAACGT
TCAGCTAGAGATGACAAGTTTGAGGTTAAGCCAGCTAACTTCTTAAATGAGTTTAATGTG
GTTACAAAAAGGGGTCCAGAGTCTATTAAGCTTGATCACATTCTTGATGAAACTTCATAT
CTCGAGTGGGTTGAGAAATTCAAGGAAGCATCACAGATCAACCATAATCCAATTTTCGAG
CTGGGAAACAGGCCAAGCTTGCCTGAAGAAAAACATCTAAAAGCTGAAGCTGCAAAGAAA
AAGGCAGAGGAGGAGAAATTGTCAAAATGGGAGACTCTTGGATACCACTCCTTATCGGTC
AAAGATCCTGTATCAGCTCCTGATACTGATATCTCCTCTGATTCTGGAGCTGTCCACTTT
GTTTACGGGGACTGCACCCGTCCTTCTAAAGTGTCTCCATCAGAGCCGACCATCATATTC
AGCTGTGTTGATACATCAGGAAACTGGGGTCATGGGGGTATGTTTGATGCATTGGCAAGA
CTGTCAACTAGTGTACCTGCAGCATATGAGCGAGCGTCTGAATTTGGTGATCTTCATCTA
GGCGATCTCCATCTTATAGAGATCACAGAGGATCTAGCTAAGGGCGGTGATTCACCTCAT
GCTCCTCAATGGGTAGCTTTGGCTGTTGTGCAGTCATACAACCCTAGGCGCAAAGTCCCA
CGCGGCAGTGTCTCCATCCCCGACTTGGAGAGATGTCTGTCAAAGGCATCGTATTCAGCT
GCTCAGAAGTCCGCATCAATCCACATGCCAAGAATCGGTTATCAGGATGGTTCTGACAGG
TCAGAATGGTATACAATTGAACGTCTGCTGCGGAAGTATGCTGCTCTCCATGGCATAAAT
ATTTTTGTGTATTATTTCCGACGTGCATCTCAGAGCTAAGAGATGGATACCATCTGTGTT
CCATCAGCAATTGGACAACATCAGGGAACAGTCCCATCAGTGCAGATCGACCTCATGCTG
CATGAAGTTGACCTTTGATCAAGATGTGAGGTAAGCAATGGAAATTTGATGTAGAAACGT
CCTAAAACAAGCTAATCAATGGTTTGGTATCTAGAAGTTGTTTGTACAACTCAGCCATAC
TAGGTTACCTTGTCAATATTTGTTACTTATCTCTTAACTATGCTAAATTAATTTGGTTAG
GTGCAAAACACTGGTGTGAATTAGTATTTCTTCTCCTTTGTCACCTGCCAGTGAAAGGGA
TATGAGCTCTAGAGAACATATAGTTTTTATCTTTAGAGAACTAGTTTATTTTTAAAAAAA
TTAAACGATTGGTAGTTTGAATGGACTAAGTAGAGAAGTTGACCGGATGGATTTATATAT
AATTGAAGTCCCACACATTTGTTACATAGTTTGTCTTTTATTTTCCTTATTAATTGTAAC
TTAATTATAAAAACATGAAATTGAAGTTACGTATCTATCGAGCATTAATGCCACAGTAAG
GTTTAGCAGTGCCATGAGTCATGGAGCTAGCACCAGAGAGGTAGTACCAAGCTAATCCAA
AATTATCAAAAGGCTTGTATTGTATAGGATGTGTTTCATCCACCAATTCCTCAGGTATAT
CTGTTATTCCTTTGTTGAATGTGAATAGCGCCAATGTATACCTTTGCTTATCCTCTTTCA
TCAACACTTGGTGCCTTGCTGCATATATTCTTCCATTGCTCCATGCCTACTTCCAAAAAC
AAAATCACTTTTT