Microarray Probes on PGSC0003DMT400066808

Probe IDChipProbe Sequence
CUST_17765_PI426222305 JHI_St_60k_v1 CACTTCAGAAGTTGGTTCCAAATTCGAGCAAGACAGATAAAGCATCAATGCTAGACGAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066808

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066808 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G00050.1 +1 3e-73 244 163/337 (48%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr4:17863-19848 FORWARD LENGTH=399

Transcript Sequence (1962 bp)

>PGSC0003DMT400066808 1962 pgsc_dm_v3.4
AAAAGTCTCCTCCCTCCTCACCCACATAATATATATGTTGAATATGACTTAAAAGTTATA
GCCAACTGTCAATCACATTTAATTTTCTTATATCTACCCTTATTCCATCTATTATCTTCT
CTCCAACTCCAAAGTTATAATTCAAACTTTTCAACACTTGCTAAAAATAATAATATATTG
TTGTTTCGATTAATTCGTCACCAAAAAAACACCTTCCTTTTATTTAACTTCGATATGAAT
CAGTGTGTACCGAGTTGGGACCTCGATGACTCTACCGTTCCTCGAAAAAATCCTATACAA
ACTCAATCCAATTCATTAGCCGCTGATGTCCCCTCATTGAATTATGAAGTGGCGGAGCTA
ACGTGGGAAAATGGGCAGTTAGCAATGCATGGGTTAGGGCCTCCACGGGCTAATAATAAG
CCCATATCGAGCTACGGTGGCACCCTTGAATCTATAGTGAACCAAGCCACCCGTTGCAAC
GACGTCCCTCCTCATCTCCACGGGAAGTCCACCGTGGACAGGAACAAAAACGGTGGAGAT
GAGGTGGTTCCTTGGTTCAACAACCACAACGCGGTTGCCTACGCTCCTCCGGCAACCGGT
TTAGTCACCATGACTAAGGATGCGTTGGTGCCGTGTTCGAGGAACACCTCGAATTCGGAC
AACCACCGATCCGTGCACGTGCCGGGGATTGACGGCTCCACACACGTGGGGTCGTGTAGT
GGCGCCACAAACAGTAGAGACTGGATGGTGGCGCCACGCATGAGAGTACGGCCCACGAAA
CGTGAGTGGAATAGCCGTACGGATATGATTAGTGTAAGTGGAAGTGAAACGTGCGGAGGA
GATAGCCGCCAATTGACGGTCGACACGTTTGATAGAGAATTTGGTACGACGATGTACACT
TCTACGTCGATGGGGTCGCCGGAAAACACCAGCTCCGACAAGCAGTGCACCAATAGGACG
GGGGACGATCACGATTCCGTTTGCCACAGCAGAGATGAGAGGGAGGCAGGTGATGATGAG
GATGATAATAACAAAAAAGGGTCTAAAAACTCATCATGTTTTACAAAGAGGAAGAGGGCA
GCCGCCATCCACAACCAGTCTGAACGAAAAAGAAGAGACAAGATTAATCAAAGGATGAAG
ACACTTCAGAAGTTGGTTCCAAATTCGAGCAAGACAGATAAAGCATCAATGCTAGACGAA
GTGATAGAATATTTGAAGCAACTTCAAGCTCAAGTGCACATGATGAGTAGGATGAACATG
TCACCAGCCATGATGTTACCATTGGCTATGCAACAACAATTACAAATGTCTATGATGGGT
ATGGGTATGGGTATGGGTATGGGCATGGGAGTTGCCGGAGTTTTTGATATCAATAACCTT
AGCCGCCCCAATATCCCCGGACTTCCTTCCTTTCTCCACCCTTCTGCCGCCACTGCCGCC
TTCATGCAGCCTATGACCTCCTGGGATAACTCCAGCGCCGCCCCTCCTCCTCCTCCTGCT
ATGCCTGATCCTTTAGCTGCCTTACTCGCTTGCCAATCACAGGTAATTAAACAAGGTTAA
TTATTATACGAGACAAATAATTTCATGGTTTTAGTTAATACTAACAAGTCAATTTTATAT
GGATGCAGCCAATTAACATGGATGCGTATAGAAGAATGGCAGCATTGTACCAGCAATTCC
AACAGCCACCAACAGGCTCTGGCCCTAAAAATTGATAGTGTATATACCATATAGTAGTAG
TTACTATCATTTTGTAAAGTTCTCCTGGTTTTCTTTACGGTTGGATTGACTAGGAGACCC
TTTTACTTGTTTCGAATTGTCATTTTTGTCTGTATACTTTTGACTTTGCCAGCTAAACAC
ATAAACTTGTCCCAAATCTGTATTTCAAATTTCATCTAAAAAGTTGAATAGACTGTTGCC
TTCGTAAAGTGGACAAGTATATATGTAAATATTGAGATCTTT