Microarray Probes on PGSC0003DMT400066595

Probe IDChipProbe Sequence
CUST_14689_PI426222305 JHI_St_60k_v1 TTGCTCCAAGTACTTTGACACATGGTATCTAATAAGCCAACACGAGATGATAAGTTTAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066595

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066595 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G15570.2 +1 3e-50 165 74/106 (70%) Thioredoxin superfamily protein | chr2:6791556-6792902 REVERSE LENGTH=174

Transcript Sequence (733 bp)

>PGSC0003DMT400066595 733 pgsc_dm_v3.4
TAATAATTGCTTCCTAACTTACAATGTACAGCTGCAGCTGTCACTGCTAAGTCATGGGAT
AAATTGATATTGAGCAGTGATACTCCTGTTCTTGTTGAATTTCATGCCACTTGGTGTGGC
CCCTGCCAGATGGTTCACCGGGTAATTGATGAGATTGCAGGTGAGTATTCAGGGAGACTA
AAATGCTATGTACTGGACGCAGATCGTGAACCGAAAGTTGCTGAGAACTATGATATCAAG
GCTGTCCCTGTGGTGTTACTGTTCAAGAATGGGGAGAAATTTGAGTCTGTTATCGGAACA
ATGCCCAAGGAGTTCTATGTGTCTGCCATTGAAAGACTTCTATCTTCATAATGAGAACGT
CATGGTAGCATATGCGCAAATTGGATAACTCTCTACTTCTATTTAAAAATTATCTTCCTC
GCTGGTGCCTTGTAATTGCATTTTCCTTTTCTATGAATCATCGGCTCGTTTTCCTCAACA
TTGACTGCTCTCCGTGAAAGCACTTCCGGCTTCTTTCTTCACAATGAAATTTGTATAGGG
TCGGTGAACTTGTGAATAGTGACTGTATTAGTTAACTAAAGATGTCCTGTTTCCTTGACG
TGTTTTTGTTGCTGTGACTAGTGACTAGTGACTAGCCTTGAGCTTTCTTAAGATGAATAT
TAGTAGTAATATTTTGCTCCAAGTACTTTGACACATGGTATCTAATAAGCCAACACGAGA
TGATAAGTTTAAC