Microarray Probes on PGSC0003DMT400066569

Probe IDChipProbe Sequence
CUST_14717_PI426222305 JHI_St_60k_v1 CATAGACCAGTTCTATGATTGTTGCAAAAATATCATACCAAATGCTTATTGGTGGCATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066569

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066569 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G15480.1 +2 1e-146 437 225/487 (46%) UDP-glucosyl transferase 73B5 | chr2:6758817-6760452 FORWARD LENGTH=484

Transcript Sequence (1841 bp)

>PGSC0003DMT400066569 1841 pgsc_dm_v3.4
CATTAGCAAAATCAGAATCCTTGTTTATCTATAAAACCATGACGAGCAAAGACGAATAGA
TATACAACACCTTCTACTTTCTTTTATCTCCTGTTCTTTTTTAGTTCATCAGCTGTTTTT
TCTTATCTATTCCCTGGCTACCATGGATAAAAGAAGCGATCAACTTCACATATACTTTCT
GCCTATGATGGCTCCTGGCCACATGATACCACTAGTAGATATAGCCAGGCAATTTGCTAG
ACATGGAGTGAAGGCAACCATTATCACGACTCCTCTCAACGCGTCTAAATTCTCCAAAAC
AATCCAAAGAGACAGAGAGATGGGCAGTGATATTAGCATCCGTACAGTCAAGTTTCCTTG
CAAAGAAGCTGGATTGCCGGAGGGCTGTGAAAACATAGCTTCTACTACTAGTACACTGAT
GTATCTGAATTTCATCATGGGCCTATCGCTGTTTCAAAACCCAATTGAACAGTTCCTTGA
GGAAGACCATCCAGATTGTCTAATAGCAGCCCCTCAATTTTCATGGGCTGTTGATGTTGC
AACCAAGCTGGAAATTCCAACACTAGCTTTTAATGGCTCTGGTTTTTTCCCTCTTTGTGC
TTTACATAGTTTGATGGAACACAAACCTCATTTGAATGTTGAATCCGAGATGGAAGAGTT
TGTCATCCCTGGCCTTCCTGACACAATAAAGATGTCAAGACAAAAGCTTTCAGAACACTT
GATGGATGAAAAAGATACCCCAGTGACTGCAATAGTTAAAGCTATTATGCGAGCAGAAAC
GACTAGTTATGGAGTTATTGTAAACAGCTTTTATGAGATGGAACCAAATTATGTAAAACA
CTCCAGGGAAGTAGTAGGGAGAAAAGTATGGCACGTTGGTCCTATTTCGCTCTGCAATGA
AGATAAATCACAAAGAGGGCAAGACAGTTCCTTTTGTGAGCAAAAGTGTTTGGATTGGCT
CGATACTAAGGAACCAAAATCAGTCATTTACATATGTTTCGGCAGTATGGCAGTCTTTTC
ATCAGCTCAGTTGCTTGAGATAGCAATAGCTCTCGAAGCATCAAACCAGCAGTTTATCTG
GGCGGTGACGCAGAATACAATCAACGAAGAGCAGAATGAGTGGATACCAGAAGGATTTGA
GGAAAAGCTGAACGTGAACGGACGAGGTTTGATAATAAAAGGATGGGCACCTCAGGTGCT
AATCCTTGATCATGAAGCTATTGGAGGTTTTGTGACTCACTGTGGATGGAACTCATTGCT
CGAAGGAGTAAGTGCCGGAGTGCCAATGATCACATGGCCGCTATCAGCTGAGCAATTTTT
TAATGAAAAGCTACTAGTAGAGATATTAAAGATTGGAGTTCCAGTAGGTTCTGAGGCTTG
GTCTAATAGAACAGATAGCACAGTCCCAATAAACAGGAAAGACATAGAAAGAGCAGTGAC
CAAAGTGATGGTTGGTCAGGAAGCTGAGGAGATGCGAGGCCGTGCAGCTGCCTTAGGAGA
ATTGGCTAAAAGGGCTGTGGAGAAAGGTGGATCATCTCACAACAGTTTGATTTCCTTACT
AGAACAATTGAGGAACGCGAAAATTACCTCTAACTGATGGGAATTTCTTCATATGTTGCT
GAAACTAAACCACTACAGAAATATTGTATCTTCGCGTTTACATCAATTTCAAATTATGTA
TACCAAATTACACTTTTATCAGTATGCAGGAGTTCTTATGCATAGTCCATAGACCAGTTC
TATGATTGTTGCAAAAATATCATACCAAATGCTTATTGGTGGCATCAAATTATATCATTA
ATGTTATAATCGTTAAATAAACCTTAAAAAAAATTGTGTAG