Microarray Probes on PGSC0003DMT400066470

Probe IDChipProbe Sequence
CUST_14687_PI426222305 JHI_St_60k_v1 GCCATCACAACCAGGTAAAAGCCCAATCTTTTTAGTTCTTTCTTTTCCAAGATTTTGTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066470

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066470 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G26500.2 +3 4e-20 89 63/105 (60%) cytochrome b6f complex subunit (petM), putative | chr2:11270370-11270747 FORWARD LENGTH=125

Transcript Sequence (2542 bp)

>PGSC0003DMT400066470 2542 pgsc_dm_v3.4
ATAATAATGTAGGGGTAAGACTTGAACGTTATGAGGACATTATTGTACTCTTTTATTTTC
CTTTTCATATATGCCTTAAAGCTCAACTATAGCTCTAAAGATTTGTGTTAAAGACAAGTG
CAACTGATAGTGTGATGATGGGAAAAAACTTTGTGAAGATAGGTAAGGCACCACGTTCAA
AACATAGACACGCAGAAGAAACTGAGGAGGAGGAATATGAAGACGAGGAGGAGGAGGAAG
AACAGAATGAGTGGGCTGGCATAGTTGAGAAAAATGCGTCATGTTCAAAGGCTGGATACC
AAAGAGCCACTGCTCGCAAGGTGAGGGACAGCCATGACCAATTTGGGGCAGATATATTCA
AAAGTGGACATGCAACGCGGCCAAGAAATCCTTACTTTATAGCGAAATTACAAGCAAAAA
GGAGAGACCAACTATACGTTCCAATTGATGTGATTAAAGGCTTCAATTTTGAACTCCCTT
CAAGCATAACCATTCGCGACTCTACTGGCAGAGAATTTGAGACAAAACTCAAGAATTGGA
AGGATGGTAGAATATGGCTAATTGGAGGATGGCATAGTTTATGCAGGTGGAACCTTGTGG
AGAAAGATGTCAAGTGTATTTGCGAATTTGTGAAAGGAAAAGGAAATAAAGTCCTTTACT
TGCAAGTTCAAATTCTTCATGAAGGATCAGTTTCCAACTCCAACACAAAACACATGGAAG
AGGAAGACGAAGAAGAAGAAGAAGAAGATTATGATGATGATGATGATGAAGAGGAGGAAG
AAACTGAAGAGGACGAAGAAACAGAGGAGGATGAAAGGACTGGTACATTTAAGAAAAATG
TGTCACATTCAAAAGTTGGAGGCAAAAGAGACACTGCTTGCAAGGTGAGGGATGTCCCTG
ACCAATATGGTGCAGATATATTCAAAAGTGGGCGCGCAACTCAGCCAAAAAATCTGTACT
TTGTAGCGAAAATACGAGTAAAAAGGAGAGATCAACTGTACATTCCGATTGATGTGGTGA
GAGATTACAAACTTGAACTCCCTTCAAGAATGATCATTCGCGATTCCGCTGGCAGAGAAT
TTGAAACGAAACTCAAGAATTGGAAGGACGGTAGAATATGGCTAGCTGGCGGATGGCGCA
GTTTATGTAGGTGGAACCTTGTGGAAAAAGATGACAGATGCATTTGTGAATTTATGAGAG
GAAAAGGCAAACGCGGCCTTTACTTGCAAGTTCATGTTCTCCATGAAGGATCAGTTTCGG
AATAGTGAACTCGTAACAAGTAGTGTTGTTTGTTGACAAATATTGAAGACTTATCTAGTT
TGTATTGATAGCTCTGACAATTAAATGCCTGTTGATTGGTGTTAAGACTAAAATCTGGTT
TATTTACATTTGAATGTTCATCCATGATTTTCTTCTGTTTTAAATGCTTACATATCATTT
GTGCAATTTTGGAAATATCTCCATAACAACTTTGAGAAAATAAAGGAGAAAGAAGTCAAT
TATGCTGCTTCTTTAGGCTAAATTTGGACAAAGGTACCATGGCCCACCCACTTTCCTGGC
TAGTTTTACAAGTTGATGAGCTATAAGATGCCTCATCCAATTTTCTTTGTGAGCCAACCA
TCTCAACACTCCCCTTATCCATTGCTCTCATATTCACCTCACAAAAAATAATATCCCATG
TTCACCCTTTTATTATCTCTCTACTTTGGCAAACTTAAAGCACTCCACAAGCCATCACAA
CCAGGTAAAAGCCCAATCTTTTTAGTTCTTTCTTTTCCAAGATTTTGTATAAACTTGTTA
CAACTTCAAATTTTTTTGTATAGGTTGGTGGTCAGAAAACAATGGCAACAATGACAACAT
TCTCTGCAGCAACAGTAAGTTCAGCAGCCATTATAGGCACAGGCAGAAACTCTTCCCAGA
AAGGAACCAAAGTGAAGTACATTAGTGGATTGAATTCATTTGAAGGGCTTAAGGCAAATA
ACCATGTTGCCTCGTTAGGCCTCCCTATGTCCACTGAACAAGCTTTTGCAAAGATTGTTA
GCTCATTGAAAACCCCATCATCACAAGCCAATGGTGGAGCTTTGTCCTCTACTTGCAATG
CTGCTCTTGAGATTTTCAGGATTGCTACCATTATTCCTGGCTTGGTTCTTGTTGGAGTTG
CTGTTGGATTCGTCCTCCTCCGAATCGAAGCTACTGTAGAGGAATCTGAATGAAACTTTG
GTCTGTTAAACATTTTCTTTTTTCCTGCATCAAGATTCACTCTCTTTCTAATTCCTATAA
TCCTCTGTACTGAGGCAGAATTGATTTGTTTTGGATATATATGTTAAACTTATAAACTAT
GAGTTACTTTAACCCTCTTATTGTATACTCTTCTTTCTAAATGTTATGTGTTGCCTGACA
AGATTTGTACCTGTAGGGCTTTGGACCATATAAGCAATACCATCTATCTAGCTTACTCAT
TCATTATAAGAATGTAATTGAATTCCCTGTTATGTGATGAAACTCTAGTCTTACTTCAAG
ATTAAGGAAAATTGGAAAAAAT