Microarray Probes on PGSC0003DMT400066419

Probe IDChipProbe Sequence
CUST_14729_PI426222305 JHI_St_60k_v1 TTGGGAGCATGGTTCTTAATTTTGAGTTGCACTTTAGCCAATGTATTCTAGATAAGGTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066419

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066419 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G65940.1 +2 9e-90 276 136/183 (74%) beta-hydroxyisobutyryl-CoA hydrolase 1 | chr5:26376830-26379161 REVERSE LENGTH=378

Transcript Sequence (949 bp)

>PGSC0003DMT400066419 949 pgsc_dm_v3.4
CAAATTCTCAAAGAAACTGAAAAGCATTATGGCTCAAACCTCTTCTAACAATGGCGGAAC
CGATGAGGTTTTGGTGGAGGAGACTGGAAGTGTTAGAACATTCATATTAAATAGGCCAAA
GAAGTTGAATGCACTTTCTTTGCAAATGATATCTCGGCTTACAGAACTTTTCTATGCCAG
TGAAGAAGATCCTAATGTGAAGATGATAATATTAAAGGGACAAGGAAGGGCTTTTTGTGC
TGGTGGTGATGTTTCACTTTGTTTTCAGAATCCTGGTAACTGGAAAATCTGTGCTAATTT
TCTCCAAAAGCAGTACACCTTGAACTATGTGATGGCAACGTATAGCAAAACCCAGATTTC
CATCCTTAATGGAATTGTCATGGGAGGCGGAGCTGGTGCTTCTATACATGGTAGATTTCG
AGTTGCAACAGAAAAGTCGGTATTTGCTATGCCTGAAGCAGATTTGGGACACTTTCCTGA
TGTAGGCGCCTCTTACTTTTTATCAAGACTTCCAGGATTCTTTGGGGAATATGCTGGTCT
TACTGGTTCTAGGTTGGATGGAGCTGAAATGCTTGCTTGTGGTCTTGCAACCCACTTTGT
ATCATCAGATGTATACTACCTCAATCTTCAGCATGTTATGCCCATTTACAATTGCTTCTA
TAGGAAATCAATTAGGTTCCTGTTACTATTATGTGTAAACTGTTCAGTATGTTATCACAA
CGGCAACACTGATATGCCCCTTTACATGTAAGAACTAAATTGCCAGTCCACTGTCTATCT
GAAGATGTCAGGCTTATGGTGTTAAGACGTTACTCTTATCTGCTGTCTGCTATACAGGTC
TTAAAAATCTTTTTAGTTATGTTCTCTTAAGACATTTCATCTAATGTAATTGGGAGCATG
GTTCTTAATTTTGAGTTGCACTTTAGCCAATGTATTCTAGATAAGGTAT