Microarray Probes on PGSC0003DMT400066383

Probe IDChipProbe Sequence
CUST_14512_PI426222305 JHI_St_60k_v1 GTTTTCTTGTAAAAGCTATGCTTATGTGATTATAAGTGGGCTAGATCAGACGTTATCGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066383

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066383 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48700.1 +1 3e-77 245 130/323 (40%) carboxyesterase 13 | chr3:18038825-18039814 REVERSE LENGTH=329

Transcript Sequence (1211 bp)

>PGSC0003DMT400066383 1211 pgsc_dm_v3.4
CTTCACACCATTAATAGTTTTCCATCCCTCTTAATTTTTTCTCACTTCACAATTCTGGTG
ATATACTCAATTTCCATGGCTTCCAACACTAACGTAGTAGCAGTTGATATGACCCCTTTT
TTCGTCCTATACAAAAATGGCACCATCAATCGACTCCGTCCAGCAGACAATGCTCCGCTT
TCCGACGATCCACAAGCCCTTGTCCGATCCAAGGATGTTGTAGTTCACCCGGAAACAGGG
GTTTCCGTACGGATATTTCTCCCCAAAATTACCGACCGGAAACAGAAAATCCCCGTCGTG
ATTTACATTCACGGCGGGGCTTTCTGTATGGGATCAGCTCGTTCCTCCACATTCCATAAT
TTCATCAGCTCTGTAGTCGAAAAGGCCAATTTCATCGCTGTTTCAGTCGATTATAGACTT
GCCCCGGAAAACCCTTTTGATACTACCTACGATGATTCGTGGGCAGCATTTCAATGGATA
ATTTCACATGCTAATGGAAAAGGTCCAGATTCATGGCTAAATGATCACGCTGATTTTGCA
AAATTGTTTATTGGTGGAGAAAGTGCTGGCGCAAATATTGCTAACGACGTTGTCGTTAGA
GCAGGGGTTACTGATCTCGATTCGAAAATCAAAATTTTGGGGCTTTATTTGGTTCATCCG
TATTTCGGGATTGAAAATGATCAACTGTACAAGGCTTTGAATCCGACAAGAAATGGTGGA
TGCTTTGAAGATCCGAGGGTAAATCCATTGATAGATCCGAGGTTGAAATCAATGGCGTGT
AAGAAGGCCATGTTTTTCGTGGCGGAGAAGGATCCTCTGAAAGAAGGGGCGATGAATTAT
TATGAGGGGTTGAAGAAGAGCGAGTGGAATGGAGAAATTGAGGTAATGGAGACGAAAGGA
GAAGGCCATTGTTTCCATTTCTTTAATCCTAAGTCGGAGAAAGCTGCTGATCTTGTGAAT
AAACTAGTTGATTTCTTGAAGCAAGAGTAGTAGGTTTGTTTTAAGGTTATTTTGCCTGAA
TTCTACTGGAGTACTTTTTTACTTATATTTAAATAACATGATGATTTTGTGGTTCTTGGT
GTTTGAAATTTTGAATTTTGAGCTCTAGCAATAGATTTAATACCAATATTCCTAAAAGTA
AGTTTTCTTGTAAAAGCTATGCTTATGTGATTATAAGTGGGCTAGATCAGACGTTATCGT
TATAAAAAAAT