Microarray Probes on PGSC0003DMT400066165

Probe IDChipProbe Sequence
CUST_14572_PI426222305 JHI_St_60k_v1 GTCTTTCCTCACTTCCGTTTCCGAATCGCAACGACCAGCTTTATTTCAGTCGTTGTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066165

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066165 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G67420.1 +3 1e-61 205 115/227 (51%) LOB domain-containing protein 37 | chr5:26904576-26905415 REVERSE LENGTH=250

Transcript Sequence (1560 bp)

>PGSC0003DMT400066165 1560 pgsc_dm_v3.4
CACCAAGTTAAAAGAAGATGTATTATCCTATCCCCAAAGTGAAGGGTGAGTCAAATGTGA
AAGGAAAAAATAGTTGGTGGAGAAAAAGATATGCGAGCACTCGTCGACGTAGTTGCGTTG
GTAAGTGGAGCATGTTGAGTAAATCGAGGGAAGAGTCTCCCATACAATGGGCGGAGAAAA
GATTCTCAAGTGCTGGCGCTGCGTTTGCACTATAATTCAACTTTCTCTCCCACCCATTCG
CGGAGACACGGAGCCGTTCTATTTACCCAATACTTTTGGAACCCCTCAAGTTCAACCCAC
ACTGCACATTGCACAATACTTTATTCCCATTCCCACTCAACCTCATCTCATGTCCACTCA
TTTTACTCAAAAGCCACTCATTATTCTTCACCTAACCATAGTTTACTTTCTTAATCATGG
TTTACCTCACTTCATCCAATAATTCTCCACCTTCCTCTTCATCTCTATATATCTCTCTCC
CTTTTATTTTCTCCGAAACTCCCTTTCTACTTTCAACATTGCTCCATTTCCTATTAATTA
CAAGTTTTGTTTGTTTATATATAATTTAGTAAAGAGTTTTAAGTTTACGTTTTCTCATCA
TGAGTTGCAACGGCTGTCGAATTCTCCGGAAAGGTTGCAATGAGAATTGCATACTCCGAC
AAAGTTTACAAGGCATTGAAAGCCCTCATGCTCAAGCCAATGCCACTGTCTTCGTCGCCA
AATTCTTCGGCAGAGCTGGCCTTATGTCTTTCCTCACTTCCGTTTCCGAATCGCAACGAC
CAGCTTTATTTCAGTCGTTGTTGTTCGAAGCGTGCGGAAGGACGGTAAACCCGGTGCACG
GAGCAGTAGGATTACTGTGGACGGGTAACTGGCACGTGTGCCAGTCGGCGGTAGAAACAG
TGCTTAAAGGAGGCGTGTTACGGCCGTTGCCGGAGTTTTCAGGTGTTACTGCTTCGCCGG
AGTTTGATTCCGAAGCAAACGACGTTGATCTGTTTAGATCACAAAGCTCCAACTTCCAAT
CTAAGAGGAAAATTATAGATGAGGTGTCGGAGGATCTAGATCTCGGACTTACATCAGGAT
TATCAACGATGGTTACCGGAGGTAAACTGAACCGGCGAACGGAGAAACGAAGAGCGGCAA
CGCCTTCATTGAATTCCGATGAATCTGATACCACAACTTTGGAAAGTGGTGTTGTATACC
ATCAAAATCCACAACAAGGAAATGAAACAAAGCTTCTTCGATTGTTCTTTTGAAGATTGA
TCCAACTTTTAGTTACCGATTACTGATTAACTTAAGCTTCAGAAGCGAATTTTGCTTTTT
TGTTGTCAAAAATGTTACGCATCTCAAACTTACTAGTTGTAAGTTTTTTGGTAACTTAAG
GAGGTAATTAATTAAAATGCTTCCATGGCATCTGGATTTCTCCATTAATGAAGTTTTGAG
GGAAAAATGAGAGTTGCCCTTTCTTTTTGCTTGCCCTCTCCTTTTTTTTCTTTTTTCTAG
TGTTTTGTTCTAATGACTCGTAACAAAAAGTCAATTGAGAATATATAAGTAATGTAACCA