Microarray Probes on PGSC0003DMT400066000

Probe IDChipProbe Sequence
CUST_51200_PI426222305 JHI_St_60k_v1 CTATGTTCATTGGTTATGGTTCAATACCATATTGACCCAATGGATAAGCTATAAAGTGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400066000

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400066000 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G69040.2 +1 0.0 654 335/454 (74%) ACT domain repeat 4 | chr1:25957843-25960079 FORWARD LENGTH=455

Transcript Sequence (1805 bp)

>PGSC0003DMT400066000 1805 pgsc_dm_v3.4
GATTTGTCAAATTTAATTTTCCCCCTTTCCTTAAAAATTACTTGCTTTACATTCTTGGTT
GGTAATGCTGATTCTCTCTGTTTGTGTTTTTATCTTTTTGTTTCTAAAGCTACAGTTAGC
TATTCTCAGAACATCATGGATGATGAATATGAAAAATTCATAAGAAGAATGAATCCACCA
AGAGTGGTGATTGACAATGATTCTTGCAAAAATGCTACTGTTATACAGGTGGATAGTGCT
AACAAACATGGAATACTCTTAGAGGTGGTACAAGTTTTAACTGATCTTAATCTTGTTATC
ACTAAGGCTTATATTTCATCTGATGGTGGATGGTTCATGGATGTTTTCAATGTGACTAAT
CAAGAAGGGAACAAGATTACAGACGAAGCGATGTTGGATTATATCATGAAGTCTCTTGGT
CCGGATTCTAGTTTCGCGTCATCAATGAGACGATCAGTTGGAGTTACTGCAGGAATGGAC
TACACTTCAATTGAGTTAATCGGAAGTGATAGACCGGGGCTATTGTCTGAGATGAGTGCT
GTCCTCACGAATCTCAAATGCAATGTGGTTAATGCTGAGGTGTGGACTCATAACACCCGA
GCAGCAGCTATAATGCAAGTTAAGGATGAGGAAACGGGAGGTACAATTAATGATCCGGAA
AGGTTGTCTATGATGAAGCAACTTTTGTGCAATGTACTTAGATGTAGCAATAAATTAAGG
GATGCAAAAACAATAGTATCTGACGGGGTCTCTCATACCGAGAGAAGGCTTCACCAGCTA
ATGTTTGCAGACCGAGACTATGAACGTGCTGCTGGTGAAGTATTGGATGAAAAAGAGAGG
CCTAATGTGAGTGTCGTTAATTGGCACGACAAGGACTACTCCGTTGTGACAATCCGGTGC
AAGGATAGACCAAAGCTTCTATTTGATACAATTTGTACATTGACCGATATGCAGTATGTG
GTTTTCCATGGTAATGTTGATGCTGAAGGACCAGTAGCCCAACAGGAGTACTGCATAAGA
CATATAGATGGTTCCCCGGTGAAATCAGATGCAGAACGACAACGAGTGATTCAATGTCTT
GAAGCAGCTATAGAAAGAAGGGTATCTGAGGGATTGAAACTAGAACTATGTACCACGGAC
AGAGTAGGACTACTCTCCGATGTTACTAGGATCTTCCGCGAGAACAGCCTCACCGTCACC
AGAGCAGAAGTGACAACTAGAGCTGGCAAAGCTGTTAATATATTCTACGTTCGCGATTCA
TCAGGATATCCTGTTGATGCTAAGATCATAGAATCCATTCGTCAGACAATCGGACAGACG
ATTCTTAGTGTGAAAGGCAACATTGCAGAGTTAAATCCAGTTCCACAAGAATCTCCAACC
AGGTTCCTTTTTGGTGGTCTATTCAAGTCTAGATCCTTTTGTAATTTCGGGTTGGTTAAG
TCGTATTCTTGAAAGACACTCGATCTAATCCTCGTCGCGTGTACATTTGATCCCCTCTGC
ATCATCAAACCTACATTGGTTCTTGCTAGGTTTAAAGGCATGTCATTTGTCTGTAAAGAT
GTTTTCGTGATCGTTTTGCTATGTTCATTGGTTATGGTTCAATACCATATTGACCCAATG
GATAAGCTATAAAGTGCTTATAAGTCAGTTTGATCAGCTTATAAGTCAAATGCCCTTTTA
CTTTTTTTGTTTTTGAATATATTTTCGTGATCATTTAGCTGTCTAGTGATTATGGTTCAA
CACCACGATGGTTCGCTAATACGCTAAAACGTGTTTATAAGCTAGTTTGACTAGTTTAAT
CAAAT