Microarray Probes on PGSC0003DMT400065492

Probe IDChipProbe Sequence
CUST_38508_PI426222305 JHI_St_60k_v1 GTGACTAGGTACTTAGGCTATAGTCCAATTTTTATGGTACATAACATTGGTTACCACATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065492

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400065492 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36950.1 +3 4e-106 323 182/362 (50%) mitogen-activated protein kinase kinase kinase 21 | chr4:17422834-17423844 REVERSE LENGTH=336

Transcript Sequence (1471 bp)

>PGSC0003DMT400065492 1471 pgsc_dm_v3.4
AAAAAAACCTATATATATATTTAACGTGTGTAAAACAGAGTTCGTTGTAACTTACAGACT
CCTCTGTTTTCTCTCTCATTCTTTACCTAAAAAAAATCCCTAAAATTTTGTAAAGATTCT
CCATGGATTGGGTTCGTGGTGAAGCTGTTGGTCATGGAAGCTTTGGAAAAGTTAATCTTG
CAATACCCAGAAAACAGAGTACTCAATTTCTTCCATTAATGGTAATGAAATCATCTGGGG
TTTCTCACTCTGTTTCGCTCGTGAACGAGAAAAAAATCTTGGATGAACTCAATGGGTGTT
CAGAAATCATACGATGTTTTGGTGAGAGTTATTCGTTTGAAAATGGTGACAGTTTGTATA
ATTTGTTGCTGGAGTATGCTACTGGAGGTTCGTTAGCGGAAAAGCTCAAGAAATCGGAGA
ATTATAAGTTGTCGGAATTTGAAGTTAGTGGATACACAAAAGGTATACTCAAAGGGCTTC
AGTATGTACATGAAGTTGGGTATGCTCATTGTGATATTAAGCTTCAAAATATTCTTCTTG
GTGAAGATGGTAAAGTGAAAATTGCTGATTTTGGATTGGCAAAGAGAGTTGGAATCAAGA
AAGATGATGAATTGCGATGTGAATTGAGGGGTACCCCATTGTACATGTCGCCGGAGATGG
TCACCGGCGGCGAACAGGGTACTCCGGCGGATATATGGGCACTTGGGTGTGTGGTAGCTG
AAATGGTTGCCGGAGTTCCAGCTTATAGATTCTCCAATGTTACAGAATTGTTAATGGCAA
TTGGGGTTAAAAATCAGTTGCCTCAAATCCCTGAAGAACTATCAGAAGAAGGAAAGGATT
TTCTAAGCAAATGCTTTGTTCAAGATCCAAGAAAGAGATGGACGGCTGAGATGCTTCTAA
AACATCCTTTTGTGGCTGATCATGATACTCTTACATTATTAAATGAAGAAATCAAGAATG
GTGTTCCATCAATATCTCCTAAATGTCCATTTGATTTCCCAGATTGGGTATCTGATGAAT
GTGCTCAATCATCGGTAACATGTTCAATTACTTTTCTACCCTCGCCGGAAAATCTGAATT
CGAGCTGTGGGTGTTGGTCTACTTCGCCGGCGGAGAGGCTCATGGGGCTAGTGAGTGAAT
TTAGTACAGAATCTGAATGGTGTTCTGATGATGACTGGGTTACTGTTAGGTGATTTCAAC
AACCAGAGCCAAAAGCAGATTTTCCAGATTTTTGAGGATGTCTTTTAGGGGTCTCTGGTT
TATTATTTTAGTGACTAGGTACTTAGGCTATAGTCCAATTTTTATGGTACATAACATTGG
TTACCACATTTAATACAATACAATAGGTTCTGAATTTTAATCAAGACAGCTTATTTACAC
TCAGCAAAGTGTACATTGTTGGATTATAGTAGAATTTAATAGTAGTGATTAATTTCTTGT
TAATGGGAATAGCAGAATGACAATATTTTTT