Microarray Probes on PGSC0003DMT400065416

Probe IDChipProbe Sequence
CUST_50045_PI426222305 JHI_St_60k_v1 TACCATGTTGGAGGAAAGGCAAAGAAAGCAGCTGATAGGGTGATTCCAGAGTTAGCATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065416

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400065416 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G52450.1 +1 3e-175 504 260/406 (64%) MATE efflux family protein | chr5:21289042-21291749 REVERSE LENGTH=486

Transcript Sequence (1347 bp)

>PGSC0003DMT400065416 1347 pgsc_dm_v3.4
ATGGATATTCAAGATATTGAGTGTCCACTAATATCAAAATCAAGAAATGAAGAATCCAAG
AATAAGAGAAAATGTGATGATTTTCTTGAAGAAGTTAAGAAGATTTTGGCATTAGCAGGG
CCTTTAATGTCAGTTAATTTTCTTCTATATTGCTTACAGGTGATTTCAGTTATGTTTGTT
GGTCATCTTGGAGAGTTAGCTCTTTCTGGTGCTTCAATGGCTACTTCATTTGCCACTGTC
ACTGGCTTCAGCTTGTTGATGGGAATGGGAAGTGCATTGGACACAATTTGTGGGCAAGCA
TATGGTGCAAAGCAATATCATATGCTTGGTATCCATATGCAAAGGGCCATGATAGTTCTT
CTTTTAGTCAGCATTCCCTTAGCCTTTATTTGGGCAAATGCAGGACATATTCTTGAAATC
TTGGGACAAAGTCCGGAAATTGCAGCCGAAGCAGGGGATTATGCACGTTTCATGATACCG
AGCATCTTTGCCTATGCACTACTACAATGTCAGATGAGATTTCTACAAGCTCAAAACGAC
GTCCTCCCTATGATGCTTACTGCAGGAGCCACAACTTTGCTGCATTTATTCACTTGTTGG
TTTCTCGTGCTAAAAACCGGCCTTGGCAACAAAGGGGCTGCTCTGGCTAATGCTGCGTCT
TACTGGATTAACGTGTTCTTGCTAGCTGCATATATTGGGATATCGCCTTCTTGCAAAAGT
ACTTGGACTGGATTTTCAGTTGTAGCATTTTCTGATATCCCGAGATACCTTACACTAGCT
ATTCCTTCAGCCGTTATGGTTTGCTTGGAGAGTTGGTCATTCGAAATGATGGTTCTGTTA
TCTGGTCTTCTTCCTAATCCGAAACTAGAAACCTCAGTTCTTTCAATCAGCCTTAATACA
TCTTCAATGATATACATGTTGCCTTTTGGACTAAGTGGTGCCACAAGCATAAGAGTTTCA
AATGAATTAGGCGCTGGACGACCAAAAGCAGCTCGTATAGCAGCATATACTGCATTGTTC
TTAGCTACTACAGAAGGAATTCTAGTAGCAATGTTTATCATTTCGATTCGTAAATTTTGG
GGGCATTGCTACAGCAATGAGGAAGAAGTAGTAACATATGTATCTGAAATGTTGATGTTT
ATAGCAGGATCACACTTCATAGATGCAAATCAATCTGTACTTTCAGGTATTGCTAGAGGA
TGTGGTTGGCAAAAAATAGGTGCAATTGTTAATTTGGGAGCTTATTATCTATGGGGAATA
CCTGCTGGTATTGTATTAGGTTTTTTCTACCATGTTGGAGGAAAGGCAAAGAAAGCAGCT
GATAGGGTGATTCCAGAGTTAGCATAG