Microarray Probes on PGSC0003DMT400065365

Probe IDChipProbe Sequence
CUST_43505_PI426222305 JHI_St_60k_v1 CCTTTTCAAATTTGTATAATTTTGCATTCAGTCTCTCGTTTGTATAAGTCGTTGGTTGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065365

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400065365 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G50850.1 +1 4e-110 342 168/200 (84%) Transketolase family protein | chr5:20689671-20692976 FORWARD LENGTH=363

Transcript Sequence (2252 bp)

>PGSC0003DMT400065365 2252 pgsc_dm_v3.4
CTCAGGCATCCTCAAAGTGGGTCCGGCACAGCTGGTGAAGTGTGTTAGTGCCACATGCCC
ACATCCTACACCTGCCATAACACACAGATTGACACAATCAGCCTAAGTAGTTAGGCACAA
CTTACTTTATACAAGCTGATGATGCAATCGTGTCATCTTGGTTTATTCGGGCAAGTCAGT
AGTTGGAAGAGGAGATGATGTTGAGGATTGCAAAGCCTAAAGTCTCTCTCAGAATCTTAA
CACATCCAATTTTTGGGGCACCTACTTTAACTCGGAGAAGTTATTCATCTGGGGTTAAAG
TTAAACAGATGATGGTGAGAGAAGCACTAAATTCTGCCCTTGATGAGGAAATGACAGCTG
ATCCTAGAGTATTTTTAATGGGCGAAGAGGTTGGGGAATACCAAGGTGCTTACAAGGTCT
CTAAAGGACTCTTGCACAAGTACGGCCCTGACAGGGTTGTTGATACCCCAATTACTGAGG
CTGGATTTACTGGACTCGCTACGGGAGCCGCATATTATGGACTTAGGCCTGTCTTAGAGT
TCATGACCTTTAACTTTGCCATGCAGGCAATAGACCATCTGGTTAACTCTGCTGCCAAAA
CACACTACATGTCTGGTGGGAATATTAGTGTTCCTATTGTTTTCCGAGGACCGAATGGTG
CTGCTCTAGGTGTTGGTGCTCAGCACTCTCAGGTATCTTGTATCAGTTTTCTGGTGGTAT
TTCTTTTTAAGGAAACAGCTGTCATGAGCAAAGATTCATGTGAAAGCACCAGCATATACC
AAGGCCCGCTCTTGGAAGAAGACAAAGCAGGGTGTGGATATCAGAGAAGTTCTTATGCTG
TTCTAAATTAAGATCACATGTGTGTACGTAATCTATAATAAGAAAAACCTTGCTGAACTG
GATGATGCTTTGAGTAAAAAAATTCAGTAGCTATTGCTGGGAGTATCAGGTTGTCGGGAT
TATGCGTCTAGTATAAGTTGACCGGTAGCCGTCGTTGAGGGTCTTTGATTATTAGAGTTG
TGCCTTGCTGTTTAAATGTGATTGAAAACAACGAGGTATTGTTGTCTGTACCATTTATTA
GCTGCTCATTGCACAACTTGCAGAAAACTTGAAAGTTGCATGCTTCAACTACTCACAGAT
TTCATGCTCACTGGTGTGTTTTATCAGGCTGTAGATTGAGAAATAACCGATATTCAACAA
ATAAATCTCTCTCAAATATGATATGCATTATCCTTTGTTGGTCACAAGAAGATGATTGTC
AGTTTATCTGGACGAAATGCATTTTGAGAAATCTATATCTCAGAAATTATTAGAACTCAA
ACTTGTCATATGATGATCAATATGCAGTGTTATGCTCCATGGTATGGGTCTGTCCCTGGC
TTGAAAGTTGTGGCGCCATATTCATCTGAAGATGCGAGAGGACTTCTAAAAGCAGCTATC
AGAGATCCCGATCCGGTTGTTTTTCTTGAGAATGAGTTATTGTATGGCGAGTCTTTTCCT
GTGTCGGAAGAAGTTCTTGATCCAAGCTTTACCCTTCCCATAGGGAAAGCAAAGATAGAG
AAAGAGGGAAGAGATGTGACAATTACAGCATTCTCACGGATGGTTGGCTATGCTCTCAAG
GCTGCAGAGACGCTTGCGAAGGAGGATATTAATGCTGAGATCATTAATATTAGGTCAATT
AGGCCATTAGACAAATCTTCCATCAATGCTTCGGTGAGAAAAACTAACAGGCTGGTTACT
GTGGAAGAAGGGTTTCCTCAACATGGCGTCGGTGCTGAAATCTGTGCTTCAGTTGTCGAG
GAAATATTCGAGTACCTCGATGCCCCAGTTGAAAGGATTACTGGTGCAGATGTTCCAATG
CCTTATGCTGCCAATCTTGAAAGGATGGCTCTTCCACAGGTTGAAGACATTGTTCGAGCA
GCCAAGAGGGTGTGTTACAGATCTATTCCCATAGCAGCTGCTGTTTGAGTTTTGTAATCT
CCACCTACTTGTATGCTTTTATTTGTAAAATAAATGTGGAGATGTTCACCGTAGTCAATT
TGGGCATTTTATTGCTCGAGAAGAATTCTACTAGAGCAGCTTTCACATATAGTAAACATA
AAAATCATATTTGTATGTTATAACTATAGTTTGTTTAATTGCACTCCATTATGTTTGTTA
TGGAGCATCATATTGTATAACTCGCTGGCTCCTTTTCAAATTTGTATAATTTTGCATTCA
GTCTCTCGTTTGTATAAGTCGTTGGTTGCCTC