Microarray Probes on PGSC0003DMT400065176

Probe IDChipProbe Sequence
CUST_50130_PI426222305 JHI_St_60k_v1 CTCTATTTGAAGGTTAAAAGTGTCTTGACTTTGTAATTGAGATGCATTGTGTGAGCTATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065176

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400065176 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G47130.1 +3 2e-80 252 135/250 (54%) NAD(P)-binding Rossmann-fold superfamily protein | chr2:19349627-19350481 REVERSE LENGTH=257

Transcript Sequence (1276 bp)

>PGSC0003DMT400065176 1276 pgsc_dm_v3.4
CCTGCAATTATTGGCCAGCTTGACGCTGAGACATCAAACTTATGGTGCTGCTTAATTAAG
CCACCTACTTCAAATATATGAGCCAAGTGTTTAGGAAGATATTTCCATTCTCAAGTAACA
GCATACAAGATAAAGCACAAAACGAACCAAAAATGGCAGAGGTCACGCAGAAGCTGAAAG
GAAAAGTGGCCATAGTGACTGGTGGTGCAAGCGGAATTGGGGAAGCAACAGCACGCCTTT
TTGCCCAACACGGCGCACGAGCCGTTGTCATCGCCGACATCCAAGATGGAAAGGGCAGAG
CCGTGGCGGTATCCATCCCTTCACAGATTTGCAGCTACGTGCAATGCGACGTGAGTGATG
AAAATCAAGTGAAAGCCATGGTGGATTGGACGGTCCAGAAATATGGTCAACTCGACATAA
TGTTCAGTAACGCAGGAGTCGTTGGTAATTCGGGTCAAAAGGTGCTCGATCTGGATCTTT
CCGAATTCGATCGGGTGATGAACGTCAACGCTCGTGGAATGGCGGCGTGTGTGAAGCACG
CAGCACGAGCCATGGTGGATAAGCGTGTTAGAGGTAGCATAATTTGTACAGGCAGTATTG
GGGCAAGCAGGGGAGGAGCCTGGCGAACTGATTACATAATGTCGAAACACGCTGTGTTAG
GATTAGTGAGATCAGCTTGTCGGCAATTGGGTGAGTACGGAATAAGAGTGAATAGTATTT
CACCCTCTGCAGTGATGACTCCATTGATGATCAGCGCAGAACCAGAGGTATCAATGAAGT
CTCTGAAAAGGTATGGTCCGCAGACTAGTTTGAAGGGTATTACACTGACGGTGAAACACT
TGGCGGAAGCTGCTCTGTTTCTAGCTTCCGATGATTCTGCTTTTGTTAGTGGGCACGATT
AGGGGGTGGATGGTGGCTTGATCAGTCTTCCAGATCCAATGAGTTCATTGTGAAACAGAG
AGAGCAACCGAATTTGAGTTTGTTTTTTTTTTTTTTTTTTGGTTTCTCATCCTGCATTCG
GTGCCCAATTGGAACTAAATTTGGATTCCTGCTCAAAGTCACAAATATGGCAAAACACTC
CCTAACTAGGGCGACTATGCATGTAGCCCGAAACATATGGTTAATCCCTTGTAATATAGC
ATGGATTTCGAATCTTCCTACCGTGTATTCTCTATTTGAAGGTTAAAAGTGTCTTGACTT
TGTAATTGAGATGCATTGTGTGAGCTATGTAAAATTATTCAAATTACAATGTTTTGATTA
TAGTATTATTTGGCAG