Microarray Probes on PGSC0003DMT400064978

Probe IDChipProbe Sequence
CUST_48631_PI426222305 JHI_St_60k_v1 ATCATTATCACCCCCTCAACGATGTTCAGATGAATTATAACGACGAATGCTACTATAAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064978

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064978 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G44480.1 +3 0.0 547 254/484 (52%) beta glucosidase 17 | chr2:18359780-18363001 FORWARD LENGTH=517

Transcript Sequence (1836 bp)

>PGSC0003DMT400064978 1836 pgsc_dm_v3.4
GTCATTTCACATATGGTGAGGACATCAAATCAAAAATATATTTGTGTGACTTGAATATGG
CAATATTTGTGGAGAGAAATTTGTTTCTACATTTCTGCCTCTTTCTGCTATTTGTAACTT
CAATTGAAGCATCAGATCCATTTAATAGCAGTTGTTTTCCACCAGATTTCATATTTGGAA
CTGGTTCTTCTGCTTATCAGTATGAAGGAGCAAGTAATGGAGATGGTAAAGGCCCTAGTA
TTTGGGATTCCTTTACCCACAAACATTCAGATAGAATAATTGACGGTAGCAATGGTGATG
TAGCCATTGAATTTTACCATCGTTATAAGGGAGACATAAAGTTAATGAAATCCCAAGGGT
TTAATAGCTTCAAATTTTCTATATCGTGGTCAAGAATATTACCATATGGGAAGTTAAGCA
AAGGAGTAAACATAGAGGGAATTGCATTCTACAATAATCTCATTAATGAGCTCTTAGCAA
ATGGGATACAACCTCTTGTCTCAATTTTCCATTGGGATTTGCCTCAAGCCCTTGAACAAG
AGTATCAAGGATTTTTAAGTCCACAAATTGTGGATGACTTTGGAGATTATGCAGAATTAT
GCTTCAAAGAATTTGGAGATAGAATTAAAGATTGGATCACAATTAATGAACCATATTCAT
ATGCGTTATTTGGGTATGTAACGGGGTCGTATGCCCCAGGCAGATGTAGTGCATTTACAA
ACAATAATATGTGTGGTGTTGGAAACGCAGCAACTGAGCCTTACATAGTTGGTCACCACA
TGCTTTTAGCTCATGCAAAGGCGGTTACTTTGTATAGGGACAAATACAAGGCTTCACTAA
AAGGCAAGATAGGAATATCGTTGATAAGCGATTGGTTTGTGCCAAACTCTACAAACAAGG
AAGATATATATTCTGTTGAACGGGCTCTTGACTTCATGTTCGGATGGTTTATGCATCCAG
TAACTTATGGAGACTATCCAGTAAGTATGCGGGAACGTGTGAAAAATCGATTACCAAAAT
TTACTAGTGAGGAAGCTGAGATGGTGAAGAATTCCTATGATTTCTTGGGGTTAAATTACT
ACACTTCATTGTATGCAGCCAATATTATTTACCCTGACACTGTCAATATTACCTACATCG
AAGATTATCAAGTATACCAAACAGGTATAAAAAATGGAATACCCATCGGCAAACGGACAG
GATCGAAAGATGATTTCGTCGTCCCAGAAGGACTTTTGGAATTGCTAGTTTATACAAAGG
AGAAATACAAGAATCCAATTATTTACATAACCGAAAATGGAATGAGTGATGCCAATGTAA
CAATAGTAGAAGGAGTAAATGACTTGCAAAGAACAGATTTTATTCGTCAACATCTATTGG
CTATCAAGGATGCCATTCAGGATGGTGTAAATGTAAAAGGTTACTTCATATGGTCATTCT
TGGATAATTTTGAGTGGAGTTCAGGCTATACACAAAGATATGGAATTAATTATGTTGATT
ATAATGATAATTTAAAGAGATACCCCAAACGTTCTGCTCGTTGGCTTAAAAAATTCCTTT
CTAGTAGAGACATTGTTTCCAGATCTGATTGTTAACACGGTTGATTAGAGGCAATAAAAT
GTATTCTCATTTTAAAACATAGCTTTATTTTTGCATAATCTCACACATTATGTAAGTCAC
GAGGGTTACGTTGGTCTTAAAATAAGGTGCTAGTCTTATACAACAATTCTCTACAACTTG
ATTTGATAAATGTTTGTAAATATTCTTTGGGTGAAAATCATTATCACCCCCTCAACGATG
TTCAGATGAATTATAACGACGAATGCTACTATAAGG