Microarray Probes on PGSC0003DMT400064780

Probe IDChipProbe Sequence
CUST_47486_PI426222305 JHI_St_60k_v1 TGGATGGTAGGCATTCCCAAATGTCCTATATGTATATTGTAACACAAATGCATGTTGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064780

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064780 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G37240.1 +2 7e-18 80 43/111 (39%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23690.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr4:17524546-17525052 FORWARD LENGTH=168

Transcript Sequence (1020 bp)

>PGSC0003DMT400064780 1020 pgsc_dm_v3.4
CCACACAACAAAATTAAAAAAAATACTCTGTTTTTTTCTCTCTTTTCTAAAAAAATCAGT
TGAAATGGGTATTTGTACATCATCACCATTGATGACAAAACAAAATGGAAGCATAATGAA
TTTGCCAGTTACAAAAGTAGCCATGGTGATTCAGATGAACGGAAAACTTCAAGAATTCCG
GCAACCCATTACCGCCGGCGAGATCCTTATCCAAAACCCTGATAACTTCCTTTGTAGCTC
AGAAGCCATGAATGTCAATTCATTAGTTCCTCAATTAGCCAAAGATGAAATCTTGCAGCT
TGGTCAGCTTTATTTTTTTTTGCCGGTTTCTAAATTGCAAACCCCGCTTTCACTTCAAGA
TATGTGTGTACTTGCTGTTAAAGCAAGCACAGCTCTTAATGATTACTGTAATATAGTAAC
CGGGTCGTCAGGAATATTAACAAGAAAATTCAAGAAAATGCACAATTGTCATACTAAGGA
TTTGAACCTGAGACCTGAAGTTTTCGAGTCACCTTTGCCACTACAATACTAGAAGTTTTC
TTTCAGGGATTCAAAATTTATATATATCAATCAGCGTCATATGATTTAAAATGACCAAGG
ATGTCGGAGGAAAATTATATGTAATTTTTTTCGATATAGTCATTTGGTATTCGCAACTCA
CTTATTGTTTACTATGGACTTGTATGGGTAGGCACGCTAAGGGAAAATGCTTCCTTATCC
AGAAGTTTATTATCTCAAGACTTAATTTGAAACGTTTAGTTAAGAATCGAGAGATCTCAT
ATCATATTTTATGGGTGAGTTTATTAATAGTTAGTGAAAGTGAAAAGATCTTGCGTAACA
CATGAAGAAATCAATTTATGTTTGGTATTAATACTAGCATGTAATTCTGTATATGTTGAA
ATAGAATGGATGGTAGGCATTCCCAAATGTCCTATATGTATATTGTAACACAAATGCATG
TTGATTTTGTCAGAGTAATACTCTGTTCATTCACTTTTATTTGTTATATCTGGACTTGAT