Microarray Probes on PGSC0003DMT400064728

Probe IDChipProbe Sequence
CUST_43608_PI426222305 JHI_St_60k_v1 AGCGCTGCTGAGCGTATATTTCTGTAATGTCCCTAATGGGAATATTTCATTCAGATGAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064728

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064728 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G29370.1 +3 2e-11 58 32/64 (50%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39240.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:11278652-11278957 FORWARD LENGTH=101

Transcript Sequence (563 bp)

>PGSC0003DMT400064728 563 pgsc_dm_v3.4
AGAAAATCCATTTTTCTCGGCTCCAAATGGGTTCACGGCCAAAAAACTCGAGTAGCTTGC
GGCTGAGAAGATCGAGAAGAAATTCTTCCAATGAAAAACGAGCAAAAAATGGAGTAGATA
ACAACAGTACCAATGCCGCCGGCGACGATAATTCCATTTCAATTTCAGAAAAATTGGAAG
CTCTGAAGCAACTTCTCCCAGTCAACAATGGCGAATTAAAAGCAGATCAGTTGTTCGAAG
AAACAGCTGGTTATATTGTTCTTCTCAGAACTCAAATCTTCGTTTTACAGAAACTGCTCG
ATTTTTGTGACGATGCATCTGGTCAGTCTCAACATATTAATGCTGTATAGTTAGTAGTAA
TTATTTCCTAATCAAACATTGCTCTCTTTTTTTTTCTTATAATTTTTATTCTTAGTAGTT
AGGTTCTCAATTGAAGGTGAGTAGTTATATGGTAGAGTTTTACATTTCTTTGAATCTGAG
TTTTAGCGCTGCTGAGCGTATATTTCTGTAATGTCCCTAATGGGAATATTTCATTCAGAT
GAATTATATATTATGCTTTAAAC