Microarray Probes on PGSC0003DMT400064274

Probe IDChipProbe Sequence
CUST_3719_PI426222305 JHI_St_60k_v1 TGAAGTTCAACCACCAAAGAGGGGTGTTTATTGGAGCATTTCAACGAGTCAAGATGTGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064274

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064274 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G67360.1 +3 0.0 1083 538/740 (73%) Subtilase family protein | chr5:26872192-26874465 REVERSE LENGTH=757

Transcript Sequence (2668 bp)

>PGSC0003DMT400064274 2668 pgsc_dm_v3.4
CCCCACTTCACTACTCTCACACTCTTTTAATTTTCCTATATATATTACCTTAAGTTTCTC
AATACTCGTTCATCCATTCCCTTTTATTAATGCAGCAGTCCAAGGGAAAAAAACACAAAT
TAATCAAAATGTCTACATACCCAGTTCTAGTTGTTGTACTTGTGTGCCTATGTCACATGT
CTGTGGCAATGGAGGAGAAGAAAACATACATCATTCACATGGCTAAATCACAAATGCCAG
TAACCTTTGATGACCATACTCACTGGTATGACGCGTCCCTCAAATCGGTTTCTGAATCAG
CAGAGATGATCTATGTTTATAAAAACGTTGTTCATGGTTTTGCAGCAAGGCTTACAGCTC
AAGAAGCTGAATCCTTAGAGACCCAACCTGGGATTCTCTCTGTTTTGCCTGAGGTGATAT
ACCAACTCCACACTACTCGGACGCCTCTTTTTTTGGGTCTTGATAAAAGTGTTAATATCT
TTCCTGAGTCAGATTCTATGAGTGATGTCATCGTCGGAGTACTCGATACAGGGGTTTGGC
CGGAGAGAAAGAGCTTTGACGATACTGGATTTGGACCTGTTCCAGATTCGTGGAAAGGTC
AGTGTGAGTCCAGCACCAATTTCAGTTCTGCCATGTGTAACAGAAAGCTTGTTGGAGCGA
GGTATTTTTCTAGGGGTTATGAAACTACTCTTGGACCAATTGATGAGTCCAAGGAGTCTA
AATCTCCTAGGGATGATGATGGACATGGAACACACACTGCTTCTACAGCAGCTGGTTCAG
TTGTTCAGGGTGCTAGCCTTTTTGGTTATGCTTCAGGAACTGCTCGTGGAATGGCCTATC
ATGCCAGAGTTGCCGTGTACAAAGTTTGCTGGCTTGGGGGATGTTTTAACTCTGACATAT
TGGCAGGGATGGACAAAGCCATTGATGATAAAGTTGATGTGCTTTCATTATCACTTGGTG
GAAGCACACCAGATTACTACAAAGACAGCATTGCAATTGGAGCTTTTGCTGCTATGGAGA
AGGGTATTTTGGTTTCTTGCTCTGCTGGAAATGCTGGACCTAATCAATTCAGTTTGTCCA
ACCAAGCACCTTGGATCACCACCGTGGGTGCCGGAACAATTGACCGTGATTTTCCAGCAT
ATGTAAGCCTTGGCAATGGTAAAAATTTCTCCGGCGTTTCACTTTACGCGGGTGATTCAT
TACTTAATAAGATGCTTCCCTTGGTGTATGCTGGTAATGCCAGCAATGTAACCAGTGGAA
ATCTCTGTATGATGGGTACCTTAATTCCTGAGAAAGTTAAAGGCAAAATTGTGCTGTGTG
ACAGAGGGATTAACGCTCGAGTCCAAAAGGGTTTTGTGGTAAAAGCAGCTGGTGGAGCCG
GCATGGTTTTGGCTAACACCGCAGCAAATGGGGAGGAGCTAGTGGCTGACGCCCATTTAC
TTCCAGCGGCGGCGGTGGGTCTAATAGCCGGCGATGCAGTCAAGAAATATTTATTCTCCG
ATCCTAATCCAACGGCCGAAATTCTTATAGGAGGAACAAAGGTAGGAATCCAACCGTCAC
CGGTTGTTGCAGCGTTCAGTTCCAGAGGCCCAAATTCAATCACCCCGGAGATACTCAAAC
CGGATATTATCGCGCCCGGTGTAAACATTCTGGCCGGTTGGACCGGAGCCGTCGGCCCGA
CGGGGATGGCTGAGGACGATAGACGGGTCGAGTTCAACATTATCTCAGGCACATCCATGT
CGTGTCCACATGTGAGTGGCTTAGCGGCTTTGGTAAAAGGAGTCCACCCAGAATGGAGCC
CGGCCGCCATTCGTTCGGCGCTCATGACCACCGCTTACACCGTCTACAAGAACGGCGGAG
CACTACTAGATGTCGCCACGGGAAAGCCATCTACACCTTTCGATCACGGCGCTGGACACG
TGGATCCCGTTTCGGCGGTGAACCCAGGTCTTGTTTACGACATAAACGCCGATGATTACC
TCAATTTCATGTGTGCATTGAAATACACTCCATCACAAATCAATAGCTTAGCAAGAAGAA
ACTTCACATGTGATTCAAGCAAAAAATACAGCGTCACAGATTTGAATTACCCTTCCTTTG
CTGTTTCATTCCCTGCTGATACCGGTTCAAACACAATCAAGTACAGCCGGACACTGACTA
ATGTTGGACCAGCTGGGACATACAAAGTTACTGTTTCTTCCCCTAATAGTTCAGTGAAAA
TTATAGTTGAGCCTGAAACAGTGAGTTTCACTCAGATTAATGAGAAGAAATCGTATACTG
TGAGTTTTACTGCTCCATCAAAGTCCTCATCTACGGATGTATTCGGTAGAATTGAGTGGT
CAGATGGGAAGCATGTGGTTAGTAGTCCAGTTGCAATTTCTTGGTCATGAAGACATAGCT
AATAGCTTCTGTTTATTTTATGTATAAGTTCATGGTTTTCTGCTTTTTAAGTTTCATTCC
AGCACAAAAGTTGGTAGCTGGTTTCAAGATTTTTTTATGGATAACATGAAAGAATCAAAG
AAATGTATGCCTTATACAATATCTTGCTCACTGTACAGTGTTGTTTTATACCAAGTATTG
TAAGCAATTCTAATATATATTTTTAACATGAAGTTCAACCACCAAAGAGGGGTGTTTATT
GGAGCATTTCAACGAGTCAAGATGTGAG