Microarray Probes on PGSC0003DMT400064096

Probe IDChipProbe Sequence
CUST_19937_PI426222305 JHI_St_60k_v1 GCAAGATCAATGTTGGGTTGATCCATTTCAAAGTCAAGAAAAAAGAAAAACAGGCACATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400064096

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400064096 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G18530.1 +1 1e-162 478 235/411 (57%) Protein of unknown function (DUF707) | chr4:10217749-10220285 FORWARD LENGTH=389

Transcript Sequence (2123 bp)

>PGSC0003DMT400064096 2123 pgsc_dm_v3.4
AAACAACTTTCTTCTATCTATCTTTATTTATACACCTATAATATAATATACATACAGGAA
CTGTATGTAGAGGTCTGGTTTCTTGAAAGATTTGAAGAGGGAGCGACATCGTTTGAGCGG
TTTTGAAAGTGATTGAATATTCAAAACATCCTTTTTAGTTCATTCTTTCTTTAGAATTTG
GTTTTTCTGTTTTTGATCCGTTGCTTTACCTATAAGGACTATTCGACTTTCTTTCTTTGA
AAAAGTTTATCTTTTTGTCTTTCTTTTTTTCTTACCCTTTTGTCAGCAAATCTTGATAAC
AAAGACCCTTGTTGTGGATTGGATTTTTGGAGCTTTATTCATGCAAAGATGAAGTCTTGG
AACATTGTTTCTGTGCCTGATGCTAAAAGCAGATCATGTATCTGCAGCCTCTTCTTGACT
CTTGCTTTAATTTGTGCGGTCTACTTTACCGGAAGTGCTTTGATGGCTAAGGATTTCAGG
GCTTTTTCAGGTTTTACAATGAACAGTACAAAGCAGAATGGACAATGCGGAAAATGCAAG
GTACCACCTCCAAGAGAAGAAAAACAAGAGAGTCATGTGACAGAGAATGTGCAAAATAAT
AAATGCCAGAAAAAGTGCAGGCCATTAGGGAGTGAGGCACTCCCAGAAGGAATTATTTCT
AAAACATCAAACCTGGAAATGCGACCATTGTGGGGTGATGTTGAGAAGAAGTCTCCACAT
TCAGTTAACTTATTGGGAATTGCAGTTGGAATAAAGCAAAAAGAGATGGTGAACAAAATT
GTTAAAAAGTTTCTTGAACATGACTTTGTTGTGATGCTTTTCCACTATGACGGTGTGGTG
GATGAGTGGAATGATCTTGAGTGGAGTAATCGTGCCATACATGTATCTGCTATGAACCAA
ACAAAATGGTGGTTCGCGAAAAGGTTTCTGCACCCGGATATAGTTTCTGAATACGACTAT
ATTTTCTTGTGGGATGAGGACCTTGGAGTCGAAAACTTTCATCCGGAAAAGTATATATCT
ATTGTTAGAGAAGAAGGGCTGGAGATATCACAGCCAGGACTTGATGCTAGTAAATCGGAA
GTACATCATCATATTACTGTGCGCAGAGGGAGATCCAAGGTGCACAGGAGGTTCTACAGA
TTAAATAGAGGTGGCCGAACATGTGATAATAACAGCACAGAACCTCCTTGTGTGGGGTGG
GTAGAAATGATGGCTCCGGTATTCTCAAAAGCCGCTTGGCGTTGTGCTTGGTATATGGTC
CAGAACGACCTGATCCATGCATGGGGATTGGATATGAAGCTTGGTTATTGTGCGCAGGGC
GATCGTACCAAGAAAGTTGGCGTGGTTGATGCAGAGTACATAACTCATTTGGCTGTCCCT
TCTCTGGGTGGTAATTCAGATGTAGAAACGGTGATCAAAGAATTAGATAATAATTCACTG
CAAGGGAAGAACTTGTCTGATTCTGATACATTGGCTGCTCCAGTTGAGAAATTTGACAAT
CGGTCTCTGGTTAGGAGACAATCGTATATCGAAATGAAGGTTTTTCGAGAGAGATGGCGT
AAAGCCATCAAGCAAGATCAATGTTGGGTTGATCCATTTCAAAGTCAAGAAAAAAGAAAA
ACAGGCACATAATGAAATTTCTCATAAGTTATATACATTCAGTTGTTTGTATATACATTG
TATACAAAGAGCAGCTAAGAGTAAATAGCCATACAAGACTGATATCTATATGCATCAAGA
GCCACAGTTACTCAGAAGAGAGAGGGGTGGTGTGTGGATGTGGAAAATTCAGTCATCTTT
CTTTTTTTCCCTTTGGGAATCATTTTTATAGATAAATTTTGTGGTATTTGTAAATACCAT
TTTTTTTCTTCTTTTCCTTTTTTTTTTGGGGGTCTAAGAATAATGCCAAGGGTGCTGTAT
AGTTATGTTTATTTATGGCATTCAATTTGGTGATTTGTTTCAGGTCAACAATAAGATTTA
TTGCTCATAATTACTGCCTCTTGGCACACTTGCATTGTATCTTGCTATTTTGCCGTCAGA
TTATTCTTGCAATCCTCTTTGAAAACAGTGAGGATTTATCGAAAACAATCTCTTTAACCC
AAAGGTAGAAAGGTTTGCGTTCA