Microarray Probes on PGSC0003DMT400063920

Probe IDChipProbe Sequence
CUST_31134_PI426222305 JHI_St_60k_v1 GTATAAAGAATTTTACAGGCCGAAAGGGCTTGACACCAGCAGAATCTGCAAAGCTTGGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063920

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063920 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G78780.2 +1 9e-43 147 69/128 (54%) pathogenesis-related family protein | chr1:29621447-29622431 REVERSE LENGTH=238

Transcript Sequence (667 bp)

>PGSC0003DMT400063920 667 pgsc_dm_v3.4
GCTTTCAAAGCCATGACCAATTAGGAAAACATATTCTCCCTATAATGCATTTTGAATTTA
ACTTACGCTGACAGTATAAAGAATTTTACAGGCCGAAAGGGCTTGACACCAGCAGAATCT
GCAAAGCTTGGTGGTAGCTACAATATATTCCTACAAACTTCATTACCAGAAAATGTTCGA
CTCTACAATCCTGACGATGAAACATTTGAATCATCACAAAATCTTTTCAGATCGATATTT
TTACGAGGATTCGCGATCGAAATCCTCCATGTTTATTCAGGACCACCAGGAATTGTTTAC
AGATTTAGGCATTGGGGTTACATGGATGGTCCATTTAAAGGACATGCTCCAACTGGACAA
CTTATTGAGCTCTTTGGAATTGGCACATTTGAATTGGATAAAGAGAGTAACAAGATTATA
AAGGCAGAGATGTTTTTTGATAGAGGAGAATTGCTTGGAGGACTTGTGAAAGGAGAAAGC
AATGTTGCTTCAACATGTCCTTTTATGAAATAAGAAGAAATTATTACTAGCAAAATGTTG
CTTATTTACAAGATGTATGTGGTTATGTTTTATTATTTTACTAAAAATGTGTAGCTTACC
TTTGAAGCACATGGTTTGTTTAATATTTCACATAAAAAGTACTCATGTTCTATGATTTTT
TTTTCTC