Microarray Probes on PGSC0003DMT400063852

Probe IDChipProbe Sequence
CUST_31143_PI426222305 JHI_St_60k_v1 CCTAATTGGAAGGAGTAATCCTCATTATCTCAAGTGTGTACTTGTAATAACTTAGACATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063852

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063852 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G21460.1 +2 1e-111 329 161/236 (68%) Nodulin MtN3 family protein | chr1:7512030-7513281 REVERSE LENGTH=247

Transcript Sequence (1091 bp)

>PGSC0003DMT400063852 1091 pgsc_dm_v3.4
AAAAAAACACAAATATATCTCTTCCCTATAATCCTAACATATTTTTTCTACATATACACT
ACCGTTTCCCTTCTCAACACAATATCTTTCTTGAATAGAAAATTAAAAACTTCTAGCTAT
GGCAATCATCAAAATTCTCCACACTTTGTTTGGGATTTTTGGCAATATTACTGGCTTGTT
TCTCTTCTTAGCTCCAATGATAACATTCAAGAGGGTTATTATGCATAAGTCAACAGAGCA
ATTCTCAGGCATACCATATGTAATGACACTTCTCAATTGCTTGCTCTCTACTTGGTATGG
TCTGCCATTTGTGTCACCAAACAACATGTTGGTATCAATTATCAATGGCACAGGAGCAGG
ACTTGAGGCATTCTATGTGTTAGTTTTCCTCATATTTGCACCAAAGAAGGAAAAAGCAAA
AATCTCTGGAATTCTATGTGTTGTCCTTTCTATCTTCTCAACTGTTGCATTGGTCTCAAT
GTTAGCTCTCCATGGCAATAAAAGAAAGGTCTTTAGTGGCTTTGCTGCTGCTATTTTCTC
CATCATTATGTATGGTTCTCCTTTGTCAATTATGAGGCTAGTGATCAAGACTAAAAGTGT
GGAGTACATGCCTTTCTTCTTGTCCTTGTTTGTTTTTCTTTGTGGCACCTCATGGTTTGT
CTATGGATTGCTTGGAAAAGACCCTTTCATTGCAGTACCAAATGGAGTTGGAAGTTTTCT
AGGAACAGCACAATTGATATTGTATGCCATTTATAGGGAAAACAAAGGACAAATCAAGAA
AGGTGAGGAAGATGGAAGAGTAGAGATGGAATTAGAGAAGCCATATGAGAAGGAAATACC
TAACACCCAAAGTGGTGATGCAAAAGTATGATGAATTTAATTAGAATATTCAATCAAAAA
AAAAAATATGTAACCAAACTTTGTGTTATTTTTTTTTTCCTAATTGGAAGGAGTAATCCT
CATTATCTCAAGTGTGTACTTGTAATAACTTAGACATCATTAGTATTCTCCTTGTTTATT
GTGAAAGTTCTTTTAAGAAATCAAGAGTCTTTTTCAAACAATTTTCTTTTTGAATTTCAG
ATTTATTATCA