Microarray Probes on PGSC0003DMT400063776

Probe IDChipProbe Sequence
CUST_12536_PI426222305 JHI_St_60k_v1 GCCCCATTGTACATTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063776

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063776 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G18750.1 +1 2e-85 289 177/440 (40%) Calmodulin-binding protein | chr2:8125827-8128363 FORWARD LENGTH=622

Transcript Sequence (2709 bp)

>PGSC0003DMT400063776 2709 pgsc_dm_v3.4
CGGCAGTTCCACAAAGTTTGGGTTGATTAGATCCTCTATATTCTTGTAACTAAACTTTCC
TCGTATTTTTCTAAGTTCACGCGGTAGGTAATTCATCGTTGCCTACTAATTCTGGTTATT
TTCTTGGATTTTTCTTCTTCAAATCTTGAAAGCCCCCATTTTTCCAAGTTGTGGATTTGA
TTAATCAGTAAAAGCAACAATATTTTATTCAAGATTCTCTTCTTTTAATGCAGAAGACGA
CATTGACTTAAACAAGTAAGTCTTTCAGTTTGAATTTTGAATAATAAACACAACCACACA
TAGCACCCACAATGTGTTTGTGTTAATGTCTAAGAGAACTACACACCCTTTGTGTTTGAC
AATATAAATTAATTGGATATATATGAAGCTTCTTACCTGTTTCCTGCTAATTTTGGGGTC
ATTATTTCTAATATAAGACTATAGTTGTTAGCAGTTGAACGTTACCTTCTAACATATTGT
GCAGGACTATTGGTATCACTCCCAAATTGGACTTTGATGGTACAGAAACGGAATATCAAT
CAGGATAATGATGAAAACTCTGAGTTTCCATCTAGGGAATCTAAGCGCCAACATCCTTCT
AATGCGTTTTTTTCAGGGTTAAGGAGTTACTCTTCTCCACAAGAACTTGCACTAAGGTTG
GAGCCCTCAATCCGAAGCTGGGTGCGTGAAGAGATTGAGAGAACACTTCAATCTACCCTG
AGATCCTCACTTAATGATGACAAGACTTCTCAATCTAGGGCTATTCAGTTACTTTTTGAC
GATATTCTCCCTTCTTCCCTTTTCACGGGCAGTAATGTATCCAGGGACAATAGGCCCATT
AAAGTTCTCTTGCATGATGCTAGTTCGAACCAGAGAATAACATCTGGACCGTTATCTTCG
GCAAAAGTTGATGTGGTTGTTCTTAATGGGGAATTTAACCCCAACGATCTAGAAGACTGG
AGTGAGGAAGAGTTCAGCAAAAAGGTTATTCGTGCAAGAGAAGGAAAACGTCCATTATTA
ACTGGAGATTTAATCATTCAGCTAAGGGATGGTGTGGGATATCTGGGTGATATCAGCTTC
ACTGACAATTCAAGCTGGGTAAAGAGCAGGACCTTTAGGTTGGGACTGAAATTGATTAAC
CGCTCTGGTGAATTTAGGGTCAGAGAAGGAGTTAGCAAGCCTTTTACTGTGAGAGATCAT
CGTGGGGAGGCTTATAAGAAGCATTACCCTCCCACTTTGGATGATGAGATCTGGCGGTTG
GAAAAGATTGCCAAAGATGGTGCTTCACACAAACGGTTGAGTAATGAAGGAATATCATGT
GTGAAAGAGTTCCTACGGCTGTTTGTCACTGACCCATCTCTTTTACGTAAGATGCTGGCT
TGTGGGAACAACATATGGGAGAAAATAACTGAACATGTGAGCACTTGTCCGTTAGACAAC
AGCGAGTGGTACATCTACAACGCCGGAGAAAGTATTGTACTTCTGTTCAACTGCATCTAT
GAACTTGTAGGTGCAATTCTTGATGGACAAAATTTCCAGTCCATTGACAAATTAGATGTA
TTTCAGAAGCGGATGGTGGAAGACTTTAAGCGTAGTGTTTATAAAAATTTGAATTGTCTA
GCTCCCCTTGAGGACCGTTCTTTGATTGGCCAAGCAGCCCTTACATCCAATCTGCAAAAT
GGCCTTTCTCATATTCCTAGTTCAAGCCAACAGAATATGAACTACTCAGATGAGCAAGGT
CAAGTGGAGTTCCAGAGCAACTCTGATCATGCCACAATTTCATCACCGCTAGCCTACACA
GCTCAACAGGATAGTCCAACTGCAGTGTCCATGCCTGAAAGCTTTCATGGAATGCAAGCA
TTTAATTCGACCTTGGCAAACAGTTTCTTGGTTGGTGATCCCTGCTCCAGTATCTACCCT
GGTGATTATGATTGGGGTTCCAATGGTTCATTTGATTCACTAGGGATGAGCGATTATCTA
CCTCCCAACAACAATTATCAGTTTGAGACACCAGTGTGGCAAGGGAATGGATTGTTAGCG
AGTTCAAGTGTTCAGCCGGTGTCACCTAATATTGGCATTCACATCACAAGACGTGGAAAT
CCTAGAGCCATTTGGTGCACAATCCGTGCTGTCCTGAAATGGAAAACATTGGTTAAGCGA
AAGTAGCTATTTGAAGGTGGAAAGGCTTTTACAAGTAGATATCTGAAGTTTGTTCGAGAT
ATAACCAGGAAACTTCACCTCCATCTCTCAGCCTATTCTTTGAACTCTTGGGTATTTTGA
AACATAAATATATTTATATGTCCATTACATATAGCATCCATCGTATATATGTGAGTAAAT
TGTACATATAGTAAGGTTTTTGTCAGGATGAAGGTGCATGTAGGATAAATTTTCTTGCAG
AAACAGTAGCAAGATATCAAATGTTATGCTACCGCAAATGCCATCGTCCTTGGAGGAGTT
TAGTGCTACCTCTTTACTAATAGTACTAGTAGTTTTCTTGTGTGTTTTCTGCATCAGATG
TAATAAATGGTGCTTGTACAGGAAGTAATATTATTACCTTAATTATTAGTTTATAATAAT
GAGATGCTATGTCAATTGTTGTCAGCTGTATCCTTGGAGCTCGTCTGGCCCCATTGTACA
TTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATTACCTAATTGTTGG
GAATCTTAG