Microarray Probes on PGSC0003DMT400063742

Probe IDChipProbe Sequence
CUST_12497_PI426222305 JHI_St_60k_v1 GAAGAATTGTCCCTTTTATATGGGGAAGAACCAGATCATTGGACTTGGAAATCTGTGCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063742

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063742 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G09155.1 +1 2e-60 198 127/278 (46%) phloem protein 2-B15 | chr1:2949831-2950842 REVERSE LENGTH=289

Transcript Sequence (1041 bp)

>PGSC0003DMT400063742 1041 pgsc_dm_v3.4
AAATAATCTCACTCTAATTTCAACAAAAATTAGCCCAAATCAACAAAAAGGCAAACAATT
AGTTCACCTAAGATAATGGATGTATTCAATGAATTACCAGAAGATTGCATTTCTTCAATT
CTTTCTCTTACTTCACCTAAGGATACAATTAGTTTCTCTCTGGTTTCATCCTTTCTCCGA
TTAGTGGCAGCATCTGATTTTGTCTGGCAAACATTATTGCCTTCTGATTGTGATAAAATT
ATTGACAAATCTGTCATTCCATTGAATTATTCTTCTAAAAAAGAGCTTTTTATTCGTCTC
TGCAATTCAATTCTCATTGACGGTGGTAACAAGAGCTTTGCGATAGAGAAATCTAGTGGG
AAAAAATCATATATAATCTCAGCTGAAGAATTGTCCCTTTTATATGGGGAAGAACCAGAT
CATTGGACTTGGAAATCTGTGCCAGAATCAAGGTTCTCAAAAGTGGCTGAGCTGAAAGTG
ATATGCAAATTAGTAGTAAAAGCAAAGCTAAGAACAAGTATGCTTTCTGCAAACACGAAT
TATGGAATTTATTTCATAATGAAAATCTCAGATCGTGCATTTGGTCTGAGTTCAGTGCCG
GTTGAGACTAGTGTGGAAATCGGCAATCGGAAAGATGTTCACACGGCGACTCTGGATCAC
CGGAACGGCGAAAAAGATCTGCCGGATGAAAAACAGAGGTATGAAAGAGTGCCGTATAAA
AGGGAAGATGGATGGATGGAAATTGAATTAGGAGAATTATTCAATGGTGGAGATGAAGAT
GAAGATGAGGAATTTACAGTGAGTTTAAAGGAGGTGAAGGGATTCCATGTAAAAGGTGGA
CTTGTCATTGAAGGCATTGAAGTTAGGCCTAAACACTAAGACTAAGGAAAATTCAAATAT
TGTTGTCATAAATTTCATTCTGTCACTTAATGATTTATTTATTTGGTTCGTGTAAAAGTT
GGTGAGAAAACCAAAAAAAAAGAGAAAAAAAATAATTGATAATGAAATATTACAATATAC
TGGTTTTCTTTGAGGGGTGAC