Microarray Probes on PGSC0003DMT400063717

Probe IDChipProbe Sequence
CUST_12377_PI426222305 JHI_St_60k_v1 GCCGAAGCTCTTAATCCGAGCTCGCTATTTTTTGTTCTTTTCTTTTGGTGTGTTTTCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063717

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063717 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G15920.1 +3 6e-64 210 108/214 (50%) Nodulin MtN3 family protein | chr4:9030742-9033343 REVERSE LENGTH=241

Transcript Sequence (1437 bp)

>PGSC0003DMT400063717 1437 pgsc_dm_v3.4
ACTTCTTTTAGTTCTCAAATTAATGGTTCATTTTAAATTTAAATTATGTATTCGCCTCAG
ACCGCTTTGGGTAAATATAGCCAGAAGTACCAAACTACAGAGGGTAACGTGTCCTGTTCT
TGTAACATTGAATATCGCTCGCTCATTATATATTTGACCTTTTGGATACCAACTTTCTGG
GCTTTGCTACTACTATTTATTGTTTACATCTACAGAGTACTTGTTTCTTTCTCTCGACTC
TATTTCTCATCCACTACTTTTTCTTTTTCCTTCACGTAACTCTTACTGCTATAATTGTTA
CCTTTCTACTTTCATCTCTTTTGTTTTTTGTTTTCCACCTTAATTCTACTTCCTTCATGG
CTAACTTTAGCTTCATCCTTGGCATAATTGGGAATGTCATCTCCATACTTATGTTCGCTG
CTCCAATAAAAACATTCAAAAGGATAATGAAGAAGAAATCAACAGAGGATTTTAAAGGGA
TACCATATATCACAACACTATTGAGCACATGTTTGTGGACATTTTATGGGTTACTCAAAC
CTGGAGGTTTGCTAGTGGTCACAGTCAATGGTACTGGTGCCATATTCCACATCATATATG
TCACTCTCTTTCTCATTTATGCTCCCAAACCTCTTAAGATTCAATCAATGAAATTGGTGG
CAATAATAAATATAGCATTTCTTGGGGCTGTAATAGCAATCACTTTACTAGCTGTGCACG
GAACCACTCGACTCACATTAGTCGGATTTTTATGCGCTGCTTTGAATATTGGCATGTATG
CAGCTCCTCTAGCAGCTACGAGGACAGTGATAAAGATGAAGAGTGTGGAATACATGCCAT
TTTTCCTTTCCTTCTTCCAGTTCCTTAATGGAGGGGTATGGACTGCTTATGCAGTTCTTG
TCAAAGATTATTTTATTGGAGTGCCAAATGGGATAGGCTTCATATTGGGTGCGGCCCAAT
TAATCCTGTACTTCATGTACTACAAGTCAAGCCCAACAGAAGAAAAAGGCTCGGCCCATC
TAATGAAAAGAGAAATTCAAATGAAAGATGTTAATGGAGCCCATGAAAATGAGAACAATA
GAAATCTTCTTCACAAAGGGAAAAGTCTTCCCAAGCCATCATTAGTTCGTCAATATAGTG
AAAGACTAGTAAAGACTCTCTCAAATACCCCATCTTCTTTGGGCTCACACAATGTAAATG
ATATTGAAAAAGGCCTCAAAGAAGCACACTAAATTTCTAATTTTATTCACCCAACTTTTT
TCTTTCTTCTTATTGGGCCTTTATATGTTGTAATGATAGCCGAAGCTCTTAATCCGAGCT
CGCTATTTTTTGTTCTTTTCTTTTGGTGTGTTTTCTAAATACACTATGAAATTTATGTAA
GTTATACTAATATAAATAATAAAATTTAATGTCCAGTTCAATGACTGACAATTTTAT