Microarray Probes on PGSC0003DMT400063352

Probe IDChipProbe Sequence
CUST_12745_PI426222305 JHI_St_60k_v1 GGGGTTAGTCCAATTTTACATCTTTAAGAAGTGAATGCATGTTCACAAGTTCTGTTGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063352

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063352 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G74310.1 +3 0.0 1446 764/898 (85%) heat shock protein 101 | chr1:27936715-27939862 REVERSE LENGTH=911

Transcript Sequence (3139 bp)

>PGSC0003DMT400063352 3139 pgsc_dm_v3.4
GTTTTCCTTAACATAAACACCTCTATCCTTTCTCACTTCTCAACCGAAAAAAACTAAAGA
AGAAAGAAACACTCGAAACTCAAAAACATACATTTGATTCTCTCCGAAGTACAAATCAAA
AGAAATTCGCTTGTTATCTGTTAAAAGTTTATTGAAAGACAGAGTAATTCATCATGAATC
CTGAAAAATTTACTCACAAGACAAATGAGGCTATTGCTGAGGCACATGAACTGGCTGTGT
CAGCAGGCCATGCTCAGTTGACACCTCTGCATATGGCTTTGGCTTTATTATCTGATCACA
GTGGTATTTTCTGGCAAGCAATTGTCAATGCTGCTGGTAGTGAAGAGACAGCTAATGGTG
TTGAAAGGGTGTTCAATCAAGCTAAGAAGAAAATTCCTTCTCAGTCACCAGCACCTGATC
AAGTTCCAGCAAGTACTTCACTTATTAAGGTGCTGCGACGAGCACAATCGTTGCAGAAGT
CTCGTGGTGACAGCCATTTGGCGGTTGATCTGTTGATTTTAGGCCTTTTGGAAGATTCCC
AAATTGTTGATCTTTTGAAAGACTCTGGTCTTAGTGCAGCAAGAGTGAAATCAGAAGTTG
AGAAACTTAGAGGAAAGGATGGAAAGAAAGTGGAAAGTGCTACAGGGGATACCACATTCC
AAGCACTTAAGACCTACGGTCGTGATCTTGTGGAACAAGCAGGAAAACTTGATCCTGTGA
TTGGTAGGGATGAAGAAATCCGAAGAGTAATTCGGATTCTATCGAGGAGGACAAAGAACA
ATCCGGTGCTTATTGGTGAGCCTGGTGTTGGTAAAACAGCTGTAGTTGAAGGGCTAGCAC
AAAGGATTGTTCGAGGTGATGTCCCGAGTAACTTGGCTGATGTTAGGCTTATAGCATTGG
ATATGGGAGCACTCGTTGCTGGAGCGAAGTACAGAGGTGAATTTGAAGAGAGGTTGAAGG
CTGTTCTGAAGGAAGTGGAAGACGCAGACGGGAAAGTAATTCTCTTCATCGATGAGATAC
ACTTGGTTTTAGGTGCTGGTAGGACTGAAGGATCAATGGATGCTGCCAATTTGTTCAAGC
CAATGCTTGCTAGGGGCCAATTAAGGTGCATTGGTGCAACAACTCTGGAAGAGTACAGGA
AGTATGTGGAGAAAGATGCTGCATTCGAAAGGCGTTTCCAGCAGGTATACGTCGCTGAGC
CTAGCGTTCCCGACACTATAAGTATCCTTCGAGGGTTGAAGGAGAAGTATGAAGGCCATC
ATGGTGTCAAAATTCAGGATAGGGCTCTTGTTATTGCAGCCCAGCTTTCGGCTCGATACA
TTACAGGTCGACATTTGCCTGATAAGGCTATTGACTTAGTTGATGAGGCTTGCGCAAATG
TGAGGGTTCAGCTTGATAGTCAGCCAGAAGAAATTGATAATCTTGAAAGGAAGAGGATTC
AGCTAGAAGTTGAACACCATGCTCTTGAAAAGGAAAAAGATAAGGCTAGCAAAGCTCGAC
TTGTTGAAGTGAGGAAAGAGCTTGATGATTTGAGGGACAAACTCCAGCCTTTGATGATGA
GGTATAAGAAAGAGAAGGAACGGATTGATGAGCTTCGAAGGCTTAAGCAAAAGCGCGATG
AACTCACATATGCTTTACAAGAAGCTGAAAGGAGATATGATCTTGCCAGAGCAGCAGATC
TTAGATATGGTGCCATCCAAGAAGTGGAAGCTGCAATAGCTAATCTTGAGAGTAGCACAG
ATGAGAGTACAATGTTGACAGAGACTGTTGGACCCGATCAGATTGCGGAAGTAGTTAGTC
GCTGGACTGGTATTCCTGTCTCAAGGCTTGGCCAGAATGAGAAGGAGAAATTGATTGGTC
TTGCTGATAGATTGCACCAAAGAGTGGTTGGGCAAGATCAAGCAGTTAAAGCTGTTTCTG
AGGCTGTGTTAAGGTCTAGAGCTGGACTAGGAAGGCCACAACAACCAACTGGTTCATTCC
TTTTCTTGGGGCCAACTGGTGTTGGAAAGACTGAGCTTGCGAAAGCTCTCGCTGAGCAGC
TCTTTGATGATGACAAGTTGATGGTCAGAATTGACATGTCCGAATACATGGAACAACATT
CTGTTGCCCGATTGATTGGTGCTCCACCAGGTTATGTTGGACATGAGGAAGGAGGACAAC
TTACCGAAGCTGTAAGGAGGCGCCCTTACAGTGTTGTGCTTTTCGACGAAGTGGAAAAAG
CTCATCCAACTGTGTTTAATGCCTTGCTTCAAGTGTTGGATGATGGAAGATTAACTGATG
GTCAAGGTCGTACTGTTGATTTCACCAACACTGTGATCATTATGACCTCAAATTTGGGAG
CGGAGTATCTCTTGTCAGGATTAAGTGGCAAGTGCACCATGGAGAAGGCCCGCGAAATGG
TCATGCAGGAGGTGAGGAAGCAATTTAAGCCTGAGTTACTGAACAGGCTCGATGAGATTG
TAGTGTTCGATCCTTTATCACACGATCAGTTGAGGCAAGTCTGCCGTCACCAACTGAAGG
ATGTGGCAGGCCGTTTAGCTGAGATGGGTATTGCATTGGGTGTTACTGAGGCCGCATTAG
ATGTCATACTAGCACAGAGCTATGATCCGGTGTATGGTGCAAGGCCTATTAGGAGGTGGT
TGGAGAAGAAAGTTGTAACAGAGTTATCAAAGATGCTTGTGAAGGAGGAAATTGATGAGA
ACTCGACCGTGTACGTAGATGCCGGACGTGGCGGGAAAGATCTAACTTATAGGGTGGAGA
ATAATGGAGGGCTTGTGAATGCTGCTACTGGGAAAAAATCTGATGTACTGATTCAGCTAC
CTAATGGGCAAAGGAATGATGCTGCTCAAGCAGTGAAGAAAATGAGGATTGAGGAAATAG
ATGACGAAGATGATGAAATGGCAGCAGATTAAAGAGAGGTTGAATAACACCATGAAAGTT
GAATATATATGACTTGTTACTTTTGTTTAAAATCCCATGTGTGGGGTTAGTCCAATTTTA
CATCTTTAAGAAGTGAATGCATGTTCACAAGTTCTGTTGATTTTGTTGTGTTGTTGCTTT
ATGTAACTTAAAAATGTCTAAATAGAAAATTGTATTTCTCTGATTTTCTGAAAAAATAAT
CTTTTTCTATCTGGGTTCG