Microarray Probes on PGSC0003DMT400063327

Probe IDChipProbe Sequence
CUST_12949_PI426222305 JHI_St_60k_v1 CTGGATTATTCATGAGCAAACATAATCATGCTACATTATTCCTTCTTCACAGGTACAACA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063327

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063327 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G02150.2 +2 8e-45 162 107/271 (39%) plastid transcription factor 1 | chr3:391522-392589 FORWARD LENGTH=355

Transcript Sequence (1427 bp)

>PGSC0003DMT400063327 1427 pgsc_dm_v3.4
AACTTATCCTTGTAAATTTATTCTCTCTTGGTCATATTTGGTCCATAAACTCATTTTCGC
CCCAAGGCTGGGGGAAATTATTATAAAAGAAGTTGAATGTTATCAAGAGTTGTTAATTCC
ATGTTGAGGTTTTGCTAGCCACTCAGATATATACAAGTTGTAGTTTATCTTCTACAAAAC
CTAATTATATCGATGATGATGATGAACGATATATGACACACATATATATATCATGAATTC
ATCAAGTGGAAATAATTTTCAGACGAAGCAAGAATCCAATGATAGTAAATTGAGCTCAAA
GACGACTAGTGCACCATCAAGTTCAAGGCAATGGGGAGTTAATAAAAACCCAAGAATAGT
ACGCGTATCGCGTACTTTTGGAGGGAAAGATAGGCATAGTAAGGTGTGCACGATAAGGGG
GCTTAGAGATCGAAGAATTAGACTTTCAGTTCCAACTGCAATTCAATTGTATGATCTTCA
AGACAGGCTTGGCCTGAGCCAACCTAGTAAAGTTGTAGATTGGCTACTAGAAGCAACTAA
ACTTGATATCGATACTCTTCCACCACTTCCTGTACCACCTGAATACTTCACTAGGTTTCA
ACAACCACCCCATGAGGAGTACTCTGATCTCCAACAAGTTCGTTCTCAATGGTTCAACGC
GAATAGTGCACCTTATTTGGATCATGGAAAAAACAAGTCAATTGCTTCAAATCATCATGA
GGAATCAAATCAAGAGGATAATCATGTCTTTACATTAGGCAATCATCGATCATCTAATTT
ACCAGCCATGCCTTTCAATTCTTATAACTATCAATGGGATGATCAGCCTAATTCGAATTT
GTCTTTAGGTCATTTTGGACACAATAATTCATTCTCATCCCAAATAGATGATGATCATCA
ATCTCATCAAAATACTAGTTTCCCTCTATCATTGGGATCATCATCTTCGCCTTTTCCTTC
CAGTTCTCAATTGTATTTCAATCCAATAACAACAACATTTCAACCTATAGTTCCATCTCC
TAATTATATGACAAATCATCATCCCATTGATCCCAGGGCTAATATGAACCATTTCAATTT
CTTAAGCTCAAATACTTCACACAATAATCCACTTGTGATGCCAACTCTTAATTTGATCAG
TTCCCAAATAAAACCCTTTAGTCTCAATGATGATCCTAGATGGATGAGTTCAAGAGATGA
TGATGATGACGATGATGATGATGATGATGATGATGATAACCAACCACATGAAGGTCGCGC
AATTTAATTCTAAATCAAGTGAAGGAAATGAATCTTCGTCTTTACTTCAAATATTTTGAA
TTAAAGTTGTTGTCCTGGATTATTCATGAGCAAACATAATCATGCTACATTATTCCTTCT
TCACAGGTACAACAAATAATTAAAGTGAATCATTCTATTTCTTGTTC