Microarray Probes on PGSC0003DMT400063242

Probe IDChipProbe Sequence
CUST_12797_PI426222305 JHI_St_60k_v1 AGCCAGAGGGCTTGAGTTTATCTTTACTGATCTTTAGCATATTTTCATCATTTGATCTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063242

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063242 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G20970.1 +3 3e-23 96 67/217 (31%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr4:11215259-11216212 FORWARD LENGTH=190

Transcript Sequence (993 bp)

>PGSC0003DMT400063242 993 pgsc_dm_v3.4
GGAGAACGTATGCTTCAAACTTTACAAGATCAATCGATGATCGATTTATATCATATATCA
TAAATACAACAAATCAAATGGAAAACAACAACAACGTTGTTACTACTAGTTTAGAAAAGC
TAGACCGGAAAACACAAGAAAAGAACAGAAGAATTCAAATGAAGTATCTTTCTTCTAAGC
TCTTTTCTCTTATTCCTCCACACCACCACCACTACTCTACTAAGGTATGAACCCTATTTT
AGTAATTAGCTTTGATTCAAACTCTGAATTTATTTTTAAAAATTCATTAAATATATACAA
ATACTTTTCCTTGACTTGTAAGTGAAACAATATAATTTCAGGATATGGTGACGCAACAAG
ACCAGATTGATCAAGCCATTACTTACATTGAGAAATTGAAAGAAAGAGTAGATGTATTAA
AGAGAAGGAAGGATAAGATTATAGCACAAGGTACAAGTGATGATTCAAATAAATTCATGC
CTTCAACATCTTGTACTACTATAAAAATACCTATGATTGAAGTTAGAGAGTTGGGTTCAA
CTATAGAGGTCATTTTAGTTAGTTGCTTGCAAAAGAAGTTCACCATGCAAGAGGTTATAA
TCATCTTAGAGCAAGAAGGAGCTCAAGTTGTTACCGCTAATTTTTCAACAATTGGCAATA
AGGTTTACTATACGATCCATGCTCAGGTGAAAATTACGAGATTAGGGGTTGATGCATCAA
GGGTATATTCGAGATTGCAAAATCTGATTTGCTAATTTTTTAATTACTTGCCAGCAGAAA
AATAACTTAGAATATTGTATTATACTCATTTCTATTCTTTTGTTGGTTATTCAAGTTGGC
ATTCTTATTGTATTAGCAAAAAATTATCAAAATCAACAAAGGGTTATAGTAGAGTGATAA
TTAAGTGCTTCATCCTTAGCCAGAGGGCTTGAGTTTATCTTTACTGATCTTTAGCATATT
TTCATCATTTGATCTAGGAGAATTAATACGAAC