Microarray Probes on PGSC0003DMT400063172

Probe IDChipProbe Sequence
CUST_12938_PI426222305 JHI_St_60k_v1 CTGTTTTGTACAGACCAGAAATATGTGCCTTACTGTACCTGTTTTATGCCTTTACAAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063172

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063172 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19000.1 +2 2e-48 169 135/287 (47%) Homeodomain-like superfamily protein | chr1:6561335-6562684 REVERSE LENGTH=285

Transcript Sequence (1352 bp)

>PGSC0003DMT400063172 1352 pgsc_dm_v3.4
CTTATCTCCATTCACCACACGCCTCTCTTAGCTCCCCTCCCTAAGCCATCTTGTCTTCTA
TATATATACATAAATTATCTCTATATGCATAGTCTTCTCCATTTAGCTCGAATAAATTCC
TGATTCTGCGAGAATGATGATGATGTCGAGTTGCTGTTCACAGTCGGGAAACGACGGCCA
CAACTCTTTCACGTGCGCCGGCGATGTGTCTGTCGGCGGCGGCGTAGGAGGAGGAGAGAT
CATGCTGTTTGGCGTGAGGATGAAGGTAGACCCTATGAGGAAGAGCGTGAGTTTGAACAA
TCTGTCTCAGTATGAGCAGCCTAATTCTAATGATAATAATAATAGCAACAGCGGAAATAA
CAATGACTCTTCTAAAGTTGCCGCCGACGAGGGTTATGCTTCTGCCGACGACGCTGTTCC
TCACCACTCCGGCAGTGGCCGTGAGCGTAAGCGAGGAATTCCATGGACGGAGGAAGAGCA
CAAGCTATTCCTTTTGGGATTGCAGAAAGTGGGAAAAGGAGACTGGAGAGGAATCTCTAG
AAACTTCGTCAAAACTCGCACACCGACACAGGTCGCAAGTCATGCTCAGAAATACTTCCT
CCGGCGAACTAACCTCAATCGCCGGCGCCGCCGTTCTAGCCTCTTCGATATCACTACCGA
CTCGGTATCTGTACTACCGACAGAAGAAACGAAAAACCGGCAACAACACTCCATTCCATC
ATTGCGTCATGTAGAATCATCCAAAATGAATGCATTTCAGGTGACATCTATGCCAGTAAA
TTTTGGGCCTGTTATGTTGCCAGCAGAAATTGAGAAGCCAATCCTTAGGCAAGGAAGTCA
AAGTTATTATTATAATGGATCATCATCGATATTCCTCCGGCCGGCTCCTGTTGTTGTTCC
AATCTCTAATTCATCAAGAATAGCTGACTTTAACTTGAATCAAAGCTCAGCAATGGAGAC
ATCTTCGTTATCGTTGACATTGTCCTTGTCATCACCATCATCATCGTCTACTAGGCACTC
AGGATTCCAAGTGATGTCTAGTTTTAATAATGGAGAGAGCATCATCAGTGTGGCGTGACA
TACCAGAATCTCTATTATTAAATTAAAATAACAGTAGTAACTAAAACATAGAAAAGGCAA
ATGGGAGTTCTATTATTAGTGGAGTAATATGTATGGTCCTTCTGTTTTGTACAGACCAGA
AATATGTGCCTTACTGTACCTGTTTTATGCCTTTACAAATATTATGTTAGTGTCTTCTTT
ATTTGTTTTGTAGTTGGAGATAAAAATTAACAATGAATAATATTGGACTTTGTGCTTCTT
TCTTGTTGCTAGTTGAGTAAAATATCAATGGA