Microarray Probes on PGSC0003DMT400063103

Probe IDChipProbe Sequence
CUST_12735_PI426222305 JHI_St_60k_v1 GAGGCGAATGTTATTAGTTTTTCGCCGTTTTTATTTTTGTTTCCTCTGTATCAGTCCCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063103

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063103 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G07920.1 +1 0.0 1035 541/737 (73%) diacylglycerol kinase1 | chr5:2525197-2528396 REVERSE LENGTH=728

Transcript Sequence (2836 bp)

>PGSC0003DMT400063103 2836 pgsc_dm_v3.4
GCAGGTTATTTTTTGTTTCTTGTTGTGTTGATTCAAAGGTTTAGGGCCCTTCAGGGGTCG
AAATGAACTTAAGCAGGATTCCAAGGATGTGTTGAATTGAAGTATCATCATCTGTGGACA
AAGGTTTCCAAGTGTTGTCGTTGGTTGCTTATACTTAATAGTAAAAGCTAATATGTTTGG
CAGCATTGGGGAAAAATGAAACTCGGTAGAGGAAACTAACGCCAGCATGGCTTTAGATTG
TGGTAGTGTTAAGGAGGTGCATGATGCTATTATTCGTAGCCTAATGCTCATCTAGGTTCC
GATTTATACTAGCATATGTGTAATTGTGTATGAAGTATGGAAATATAGAATTCCAAAATG
GAAGATTATAGAGAATCAGAGTTTCCACTTCTTAGCTGGATCAGCAAAAATCCTTCTGAG
ATGGCAGAATCCCCTCTGTTTATTCTTTCCTGTTTAATTGCTGGTTTAGTAGGAATTTTC
ACTATATTTTACACAGCTTTCCAGTGGAGGAGGAACATAAATGGTAGTTGGATGAAAGCC
ATAGCCAGGTCTAAGAAAAACCCCAAAACAAGGAATAAGGTCCCTGCGGCTCCTCATACT
TGGGCTTTGGAGACCGTTTCTCGAGGGAAAAGTTTAAAATGCTGTGTCTGTTTGAAGTCC
ATTTCTCCATCTCAGACTCTTGGTCCAATTGTTGCTTCAGAAAGATTTTTTAATCGTTGC
AGCATATGTGGTGCAGCAGCTCATCTGAGTTGCTCATCGAGTGCTCACAAGGATTGTAAA
TGTGCATCTATGTTTGGATACCCACATGTGGTACATCAATGGGCAGTGCGCTGGACAGAG
GTAGCTGATCAACCTGATGAATCTTATTTCTGCAGCTACTGTGAAGAGCCAAGTTCATTT
CTTGGTGGGTCCCCTATATGGTGTTGCTTGTGGTGTCAGCAGCTAGTTCATGTTGATTGT
CATGCCAATATGTTCAATGAAACAGGTGATATATGTGACCTGGGCCCTTTCAGAAGGCTT
ATTCTATCGCCACTTTATGTGAAAGAGTTTAACAGGGGAGGACTGCTGAGTTCTATCACA
CAAGGTGCCAATGAAATTGCTTCTTCAGTCCGTGCTAGTATAATATGTCAAAGCAAGAAA
TATAAGCACAGTAAAGAGAAACATGAGAGTGGGACCTCTGCAGAGACAAGCAATGGTGAT
GTTGTTGGGGACACAACTACTGAATGCACTGCTGATTCTCATCAAGTGAATGGTAATATA
GATGAAAACTGCAGTAGTGGTGTAAATAGAGAGGGTGCGGATCAGCACCAAGACAGTGGT
GTTAAAAAGTTGATATCTATACCCAGCTTCAAAAGGAGTTCATCCATTAATCAGAAGGAT
GAATCTCAATTAATAGGGCAGAAATATGAATTGACTGATTTGCCTCCAGATGCCAGACCT
CTGCTAGTTTTTATAAACAAGAAAAGTGGAGCTCAACGAGGAGATTCACTTAGGCAGCGG
TTGAATCTTCTATTAAACCCAGTTCAGGTCGTTGAGTTGAGTTCAACAGAAGGACCGGAA
GTTGGTCTGCATCTTTTCAGAAGAGTGCCACACTTCCGGATTCTTGTCTGTGGAGGTGAT
GGAACTGTTGGCTGGGTATTGGATACCATAGATAAACAAAACTATGTTTCTCCTCCACCG
GTGGCAATACTCCCCGCCGGGACGGGAAATGATTTGGCTCGAGTTCTTTCCTGGGGAGGC
GGTTTAGGATCAGTTGAGAGACAAGGTGGTCTTTGCACACTTTTGCATGATATAGAACAA
GCAGCAGTAACTATCCTTGATCGATGGAAAGTTTCTATAGTAAATCAGCAGGGAAAGCTG
CTTGAACCCCCAAAGTTCTTGAACAACTATCTTGGGGTTGGTTGTGATGCAAAGGTTGCA
TTAGAAATCCATAATATGAGGGAGGAAAACCCCGAGAAGTTCTACAATCAGTTCATGAAC
AAAGTTCTTTATGCCAGAGAAGGTGCCAGGAGTATCATGGATTGGACATTTGCGGATTTT
CCATGGCAAGTTAGGGTGGAGGTTGATGGTGTGGAGATTGAAGTTCCCGAGGATGCAGAA
GGTGTTCTTGTAGCCAATATTGGAAGCTACATGGGTGGAGTAGACTTGTGGCAGAATGAA
GATGAACACTATGACAATTTTGATCCTCAATCGATGCATGATAAGATGCTGGAGGTTGTT
GGCATTTCTGGGACGTGGCATCTTGGGAAGCTTCAGGTGGGGCTTTCCAAAGCTCGGAGG
CTTGCACAGGGTCAGTTGATCAAAATTCATCTTTTTGCTGCATTTCCTGTTCAAATAGAT
GGTGAACCTTGGTATCAGCAACCATGTACATTGACAATTACTCATCATGGACAGGCCTTC
ATGCTGAAGAGAGCAGCAGAAGAACCTCTAGGTCATGCAGCAGCAATAATTGCGGATGTG
CTTGAGAATGCTGAATCCAATAAAGTAATTGACGCTTCACAGAAGCGGGCACTTCTTCAA
GAAATGGCCATCAGACTCTCTTAGACACCAGCACATTGATTTGTTAGTTTGCAGCAGTAA
ATCATACTTTTGTATAAAACCCCAACTCTTGCTTTTTTTTTTCCAGGTTATTTCATTTCA
CGTGTAAAATATACTGTATATGGAAATTAAAATGCTTGTTTGTATAAAAACAAAAAACTA
GTCAGCGTTAGAGTGAAGAGGCGAATGTTATTAGTTTTTCGCCGTTTTTATTTTTGTTTC
CTCTGTATCAGTCCCATTTCTTCTATTTCGAGTTGGCTGAGCTATTTTTATTATTTTAAC
TACATGAAATTATTGT