Microarray Probes on PGSC0003DMT400063064

Probe IDChipProbe Sequence
CUST_12858_PI426222305 JHI_St_60k_v1 GTTCACTGTTTTTCTACTGAAGCAAAAGTTGGATTTCCTAGATTTTCTTATCGCTGACTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063064

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063064 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G39040.1 +2 5e-23 63 36/69 (52%) transporter associated with antigen processing protein 2 | chr5:15625660-15629621 FORWARD LENGTH=644

Transcript Sequence (841 bp)

>PGSC0003DMT400063064 841 pgsc_dm_v3.4
TCAATGCTACACGACAAATTATACAAAGACACAAATATAAAACTCACCACCCATTTCATC
ATTCACTCCCACACTTTCTTCCATTTTTGAAAAGCTCTACCTGTGACCACCACACTTCCA
TTCTCAATCCATGGACGGCCATTCAGGAATGCATGGCCATGGTTTCGGTAATGCCAGAAC
TCCTTTGTTAGACAGACATGCCTTAGGGAGAAAGAGAAATGATGCTGGAGATGATCAGCT
GGGAGACCTTGAGCATGGTGATTCTGTTCCGGCACCAAATGTTGGATTTGGCAGAGTTAT
TTCACTTGCAAAGCCTGAAGCAGGAAATTTGGTACTGGCGACAATTGCTTTGCTGTTTGC
AGCAACATCAAGCATTTTGATTGTCGGTACCTCTTTTTCAGTTCACTGTTTTTCTACTGA
AGCAAAAGTTGGATTTCCTAGATTTTCTTATCGCTGACTTTATAATGCTCAATTTTGCAG
CCAAAATTTGGGGGAAAGATAATTGATATTGTTTCAGATGATATCCAAACACCTGAACAG
AAATCAGAAGCTTTAAATGCAGTCAAGAACACAATACTTGAAATCTTTCTGATTGTCATT
GTTGGGTATTCCCTGCAACTTTTGGCCAACTTTCTTTTTCTATCTTTTCATGCTCTGCTA
AAGCAAATCTTCAATTTAATTATTGGTAACCTGAATCGTTGCTTGGAGTTTGTATTCTAC
TAATCTAGGCTTTCACGGTGAAGGGGGCACAATGAGACACTTGGCCCCTCCACAATGGGT
TTCCCCTTCAATTGCATTTTGTAATGTTTAACTTTGCAACAATAATTGTACTAAATCGAC
C