Microarray Probes on PGSC0003DMT400063030

Probe IDChipProbe Sequence
CUST_12789_PI426222305 JHI_St_60k_v1 AAGCAACGCTCATGTACTACTTCCACATGCATATCTATAGATGTGGTTGCAACAAATTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063030

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400063030 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G69010.1 +3 1e-23 99 77/213 (36%) BES1-interacting Myc-like protein 2 | chr1:25941804-25943599 FORWARD LENGTH=311

Transcript Sequence (952 bp)

>PGSC0003DMT400063030 952 pgsc_dm_v3.4
CGGACTTGTGTGTTTTCCAATTTTGTTCTATTCTCTCCTCTTTGAAGGATATCAAGCAGC
CTTCTCTGCATAGAAAGGAGTTTGCTTGAATGTTCTGTTCTGTTACAGATTCCTATACAG
TTTTATGTTTTCATCCCTTCAAAACGTTGATTATCAACAACTACTTTGATTGACTTTTGG
ACAAAATAAAGTGATATCTAGTTAAACATCTAAATATTCTTTTAATTTTCAGATTTCAGA
TGTTGAGGGGAATCATCCCTAACAGTGATCAGAAAAGAGATAAAGCGTCTTTCTTACTGG
AGGTTATTGAATATATTCATTTTCTACAAGAGAAAGTGCACAAGTATGAGGAATCATACC
AAGGCTGGGACAATGAACCTCCGAAGTTGCAATTGAGCAAGTGCCATAGGACGAGTCATG
GTGTTAGCAATCTTCCTCAACGCATTATCAATGGATCCGCTGCTGCACTGACGTATGCCG
GAAAGTTTGATGAGAGCATAATGGGGATTTCTTCTGCTAATCCTATCAATGTGCAAAAAC
TGGAACCAAACATAAGCAGCCCAAGTTTAAAGGAAAACCGTCAGCAGCCTGGTTTAACAA
ATAAGCCGACAACACTTCCTATGCACCCAAATACATTTTCGTTTTCTGGGACTAGTAGCA
CTGCAGCGCTATATTCATCAAAGCTGACAGCTGATACTGATAAGTTGGAGCCAAAGTCTC
AGTCTCAATTTTCACTTAGCAGATCACATATGACTGATTATGCTATTCCAAATGCTAATC
CAGAAAGGCAGGAGCTGCCTATAGAAAGTGGTACCATCAGCATCTCTAGTGCCTATTCTC
AAGGGTAAAGATTCTATTAGTGCTTAAAAGATTCTGAAATTTATCTTTTAAAAAGCAACG
CTCATGTACTACTTCCACATGCATATCTATAGATGTGGTTGCAACAAATTAG