Microarray Probes on PGSC0003DMT400062981

Probe IDChipProbe Sequence
CUST_12936_PI426222305 JHI_St_60k_v1 ATTCCATCAGAGTTAGTCTACACCATGCAATAGATGTCACTTTTGTGCTAAATGCCTCTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062981

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062981 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G23060.1 +2 3e-160 466 236/357 (66%) calcium sensing receptor | chr5:7736760-7738412 REVERSE LENGTH=387

Transcript Sequence (1702 bp)

>PGSC0003DMT400062981 1702 pgsc_dm_v3.4
ATCACACATTGCCCATCATCTATAATAGTAGTTTCAATTAGTAGGACAAAATCCATTAAT
TCATCATAATCAACAAGAGTCTGCAAGCAAGCAGTGGCAAAGAGGCTGAAAAGTGATGGC
ACTTAGAGCTTCAGCCACCGCTAAATCACCTCTTCCTCCGCCCCCTTCTTCTTCTTCTTC
TTCTACTTCATCACCACCTATAGTCTTAAATCTTCCTAAACTTACTCAAAAAACTGTGTC
AGTGGCATTCTCTACATCCACTGCACTTTTCCTCTTTCCCCTTTTCACTGCGACCCATGA
AGCCAGAGCAATCAGCTTACCCAAGGAAGACATAGTCTCTTCCCTTAATCAGGTAGAATC
TGCAGTTAATCAAGCTCAAGAGGTTGGTTCGAACATCTTTGATACTATAAGCGGAGTGAT
TGGGCCCGTGATTGAATTTGTGAAACCCGGGATTGATGCAGCATTGCCTTTAGTAAAGCA
AGCAGGAGAGGAAGTTTTGAAGAACGCTTCTCCTGTCATATCTGATGTCACTAAGAAAGC
CCAAGAGGCAATGCAGAGTGCTGGCATGGACTCTCAGCCAGTGATGACTGCAGCTAAGAC
AGTAGTTGATGCAGCTCAACAGACATCCAAGGTGATTGAAGGGGCCAAACCAATCGCCTC
ATCCACAGTTCAAACCATTTCATCAACTGATCCAGCTGTTATTGCAGTGGCTGGTGGCAC
ATTATTCCTGGCATATCTTCTACTTCCCCCTGTCTTCTCCGCTCTCTCTTTCAGCTTTCG
TGGTTACAAGGGTGAACTAACTCCTGCTCAAACACTGGACAATATGTGTTCTAAGAATTA
TGTCTTGATTGATATTAGAACAGAGAAGGACAAGGATAAGGCTGGAATTCCTCGTCTTCC
ATCTAGTGCTAAAAACAAGATGATTCAAATCCCTTTGGAAGATTTGCCGAGTAAAGTAAA
GAGTCTTGTGAGAAATCCGAAGAAAGTGGAAGCTGAAATAGTGGCTCTGAAGATATCATT
CCTCAAAAAAGTCAACAAGGGGTCTAACATTGTCATAATGGACTCGTACTCTGATTCAGC
TAAAACAGTTGCTAAATCACTGACGAGCTTTGGCTTCAATAACTGCTGGATCATGACTGA
TGGCTTCTCCGGAGGCAAGGGGTGGTTGCAGAGTCGGCTAGGAACAGATTCATACAACTT
TTCTTTTGCAGAAATTTTATCACCATCAAGAGGCATTCCAGGTAGACGTTTTGGTACAAC
TGGCACTGTCAAATTGCTTTCAGATTAACAAGTCTCCCTTGTAATGACCATCAAATTGGC
CATAGTATAGTTGAATTCTTAAAGATAGCCTGCTTTAATTCTTTGATCAGTTCTAATGAA
CTATCTTCTTGCCTCTGTTTTTCTCTTTGTTTTGGCATGTCACTGCATGCTTTCGAATCC
TATTTGTACACCCAACATAAGAAGTTCAGCCATATGATACATAGAACAGGGTGTGACTCC
TCACAGAAACAACTCCGGATCGATTTTCAAGCAGTTGGTACCTAGCCCTTCTTTTTTTGA
ATTTCTATCAGGTGCCAATGTTGAACAAATGCAGCATTTTGGTTGCTGCATTTTCAATGA
TACTGCAAACCAATGTAACTACATTCCATCAGAGTTAGTCTACACCATGCAATAGATGTC
ACTTTTGTGCTAAATGCCTCTC