Microarray Probes on PGSC0003DMT400062907

Probe IDChipProbe Sequence
CUST_12955_PI426222305 JHI_St_60k_v1 GTGGCTTTTTATCAGGGGAAGTCTACTTTCCTTGGCTCATAAACTAAGAAAATTCAATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062907

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062907 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10200.1 +2 4e-90 272 122/174 (70%) GATA type zinc finger transcription factor family protein | chr1:3346677-3347763 REVERSE LENGTH=190

Transcript Sequence (1092 bp)

>PGSC0003DMT400062907 1092 pgsc_dm_v3.4
AATGTGGACAGCCAATATTTGAAAAGGCTTGTCCGCTGCTACTACTTCAACACGCCCGCA
CTTGTTCTCTGACCTCTAAATTACCCAAATTTTCAACTTCGAAGACTTAATTAGAGACTG
TTTGCATCTCTTTATTCTTTATTGAATCGATCGATTGATCTTTCTGCAGAGAAAAAAAGG
AATGGCAACTTTTGGAGGGACAACACAGAAGTGTAAGGCCTGTGAGAAAACTGTCTACTT
GGTGGATCAACTTAAGGCTGACAGCAGGGTATATCACAAGTCTTGTTTCAGATGTAATCA
TTGCAAGGGTACTCTTAAGCTAGGTAACTACAATTCCTATGAAGGAGTTTTATACTGCAG
ACCTCACTTTGATCAACTATTCAAAATGACTGGAAGCCTGAACAAGAGTTTTGAAGGGGG
TCCAAGAACAGTCAAGGAAAGATCTCTTGATAAGGCACAAGCAGCCAACAAAGTTTCAGC
TTTGTTTGGTGGAACACAAGACAAATGTGTTGCGTGCAAGAAAACTGTCTACCCCCTGGA
AAAGGTGGCTGTTGATGGCACTTCATACCACAGGCCTTGTTTCAAATGTAGCCATGGGGG
TTGTATAATCAGTCCATCGAATTATGTGGCCCATGATCACAAACTCTACTGCAGGCACCA
TCATACGCAACTCTTCAAGCAGCGAGGTAACTTCAGCCACATGGAAGATCATGAGAAGAT
TAAAGGGGTGACTGAAAATGGAAAAGCATGAGGTCCTTCCATAAAAGCTTTCATTTTCGT
GTGATTTTGCTATACAACAACATCGAGAGTCGGCTTTCTGGCCTGAATCAGGTGCAGAGG
TCAAACATATATATACAAGAGGGGTTATTTACAATGCCTATATGTGATATTTTCATGAGA
GAGTCAACAAAGTTTTACTTCATTTTTCTTTTTATCTTGGTGTGTGTTTTACTTGATAAA
TCAAATAGTTTTGCCTAAAGTTTGTATAATGTGATTGCTCTTGTGGTTGTCTGGAAATTG
GAGTGGCTTTTTATCAGGGGAAGTCTACTTTCCTTGGCTCATAAACTAAGAAAATTCAAT
TTTTTCAGTTTC