Microarray Probes on PGSC0003DMT400062826

Probe IDChipProbe Sequence
CUST_52647_PI426222305 JHI_St_60k_v1 TTTGCAAATACAGAGAGGCTGAATTGGGGTCAATGGGGAATCTGCATTGGATTTGCAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062826

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062826 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G22910.1 +1 0.0 577 285/349 (82%) ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein | chr3:8116335-8119388 REVERSE LENGTH=1017

Transcript Sequence (1050 bp)

>PGSC0003DMT400062826 1050 pgsc_dm_v3.4
ATGATCACTGGAGACAATGTGTTCACTGCAAAAGCCATAGCAACAGAATGTGGAATTCTT
CATCCTAATCAGGAAGTAGATGAAGGGGCAGTCATAGAAGGTGAAGAATTTCGCAACCTA
ACAGATGAAGTACGGATGGAGAGAGTGGAGAAGATATGCGTGATGGCAAGATCATCCCCT
TTTGACAAACTTCTAATGGTGCAGTGCTTGAGAAAGAAAGGTCATGTGGTCGCGGTCACA
GGTGATGGAACGAACGATGCACCAGCTTTAAAGGAAGCAGATATAGGACTTTCCATGGGG
ATTCAGGGCACTGAAGTAGCTAAAGAGAGTTCTGATATTGTCATCTTGGATGATAACTTT
GCTTCAGTTGCCACAGTTTTGAAATGGGGAAGGTGTGTCTATAACAACATCCAGAAATTC
ATCCAATTTCAGCTCACAGTAAACGTGGCTGCGCTCGTGATCAATTTTGTAGCAGCTGTT
TCATCTGGTGAGGTACCACTCACAGCAGTACAGTTGCTATGGGTAAATTTGATCATGGAC
ACATTAGGGGCATTAGCACTTGCGACAGAGAAGCCAACCGAGGAACTCATGAAGAAGAAA
CCAGTCGGTAGGACTGCACCGCTTATCACCAACATTATGTGGAGAAATCTAATGGCTCAG
GCCTTATATCAGATTGCTGTTTTACTGACCTTACAATTCAGAGGAGAATCAATCTTTGGT
GTCAGCAAGAGAGTAAACGATACGTTGATCTTCAACACGTTTGTTCTTTGCCAAGTGTTC
AATGAATTCAACGCGCGAAACATGGAGGAGAAGAATGTTTTTAAGGGAATATATAAGAAC
AAGCTGTTCATGGCAATCATCGGAATAACATTGGTTCTCCAAGTGGTGATGGTGGAGTTT
CTAAAGAAGTTTGCAAATACAGAGAGGCTGAATTGGGGTCAATGGGGAATCTGCATTGGA
TTTGCAGCTGCATCTTGGCCAATTGGTTGGCTTGTCAAGTGCATAAATGTCCCAGAGAGA
CCAATCTTCAGTTATCTCAGGTTAAAATAG