Microarray Probes on PGSC0003DMT400062678

Probe IDChipProbe Sequence
CUST_4875_PI426222305 JHI_St_60k_v1 AATTGCCTTTGGCCTTTCATCCCAGGTTGATCAAGTTGTTGACCCTGTTGAATTGCTCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062678

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062678 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01390.1 -1 4e-16 77 38/48 (79%) vacuolar membrane ATPase 10 | chr3:150265-150922 REVERSE LENGTH=110

Transcript Sequence (2349 bp)

>PGSC0003DMT400062678 2349 pgsc_dm_v3.4
ATTGCAGGGAATAATCCCAAGTTCAATAGCTATGACAATGTGTTGGGCATTTCTACTAAT
TGAAGCACTTGTGCTAGTTGAAATCAATGTGGGGTTACTCAAAAAGAACAAAGTGAAATT
TGAAGACGGTGAACTAGAGATCATTTCGATTAGAACAATGGCTGAAGAAACACTAGGAGA
ATGGGGTGGAGCCTTGGCTACAATAACCTACGTCTTCTTAGGATACACTTCAATGATTGC
TTACATTTCCAAGTCCGGTGAAATCCTCTGCCATTTGATCAATCTACCGGAATCAGTTTT
GGGCTTTTTCTTCACTTCCCTCTTCACAATTCTCATATCTGTAGGTGGGACAAAAGCCAC
TGATCAAGTCAATCAGTGGCTCACTGCTCTTATGATAGGTAGCTATGATTGAATGTTTTC
GTTTCAATTTGTTTAATGAAGGAAAAAGGGTCATCTGAATAAAAGTTCAAACAGGACTGC
TTGTGGCAATTGAGGTTCTAACCATTCTATATGGAGGGTGGTCAGGAGACGAAGTAAGCA
GTGATTGGGGAAAAGTTCCATCAACCATACCAGTATTAATATTCTCTTTAGTCTACCATG
ATCTAGCTCCTGGTGAACAAACACAAACAATTTTTTTACAAGTGTTTTCTCCTTATTTTT
TTTTCTCTCACCAATTTGTGATTGTTGTTGCAGTTCTGTGTGCTTACCTGGAAGGTGATC
TGAAACGAATAAGAGCTTCTGTGTTGATTGGTGGTCTGGTTCCCCTCCTAGCGTTGCTTG
TTTGGGATGCAATTGCCTTTGGCCTTTCATCCCAGGTTGATCAAGTTGTTGACCCTGTTG
AATTGCTCCTCAGGGTCAAATGGAGTGGAGTTTCATATATGGTACAGGCATTCTCTCTTC
TAGCTGTGGGGACATCTCTAATTGGTACTCTTCTAAGTTTCTCTGAGTTTCTCAAAGAGC
AACTCAATAACCTTAACCTGCAATCGCGTGTATCCACAAGATTAGATTTACAGGTAACAT
TTGGCTTCTTGGGTGTAAATTTAGTGTCTCTTGTCTAACTACTTTAATTTAAAACCTAGC
AGAGATCAACTTCTCAAATCCGTCTAAGAAAATGGTGGATAAGAAACAATTTAGGCTTCA
CAGCAACAGCAATTGCCATTGCTCCCCCTCTACTTTTGTCAACAGCAATTCCAGATGCAT
TTTCTGCTGCTACAGATATAGCAGGCGGTTACTGCATGACAATGCTATATGGCATTCTAC
CACCAGCAATGGCGTGGGCTATGCATAATAGCAAAGGAAAGGACAGTGAACCAAAAATAT
CAATAGCAAGACCTGCCCTTGTCACTGTAGGAATAGTTGCGTGTGGTATAGTTGCAGTAC
AAATTCTTCAAGACCTCTCTATGTTGCATTCTTGAAGTGTATCAGTCTGATGCTAGACAT
TGTACATATGTATTACAGAATAAAAAATCTTCTCAAGATCATGGTAAGAAAAAGCATATT
GAAACTGCAAATTTATCAACAGAAAGAAAGTCACACTCCTGTTTACAGCTGCATCACTTC
ATATAACACAATACATGCAGAGACAAGTTCATTACATAACTCCCCGGAATCTAGATACAT
ATAAGAAACTGACATGCTGCCTAGACGCTGAACCTTGGTTTCTGATCTTTCGTTTACAAA
ACATAGGTCGAAAGGAGCTCAAATGAGTTGCTTTATTCAACAGAGCAAGACAATAAATAA
TGATAACAAACATACGATACAAATGGTGAACATCCATCAGACTGATCAAGCACAAGAACC
ATGAATGGGAGGAGCATAATTCTGCAAAATGACATTAAGCGTGACCCACTACATCCACAG
AAGATTTTAGTTCTTCACTGTGGTTACGTGCCTCAGAAGCATTTGGACAACATCAGCAGA
GACTCTTGACGCTTCAGTCTTCAGGTGTTCGATCTTTTCATTAGTTTCAATCTCAAGACG
TTTGACATTAGCACCTGAGTCACCACTAGTCTGTAAATGAGAGAAATCAGGAACCATGCT
TAGTCAATTATAGAGAAAAGAAGTCAGACCCACAGCCCAAAACATCTCCTTTCTCCCACA
CCCCCACAAGGACAGAGAAATTGGAAAATCGATGCAGTTCTGAGTGAGTATATTGTTAGT
GTCGGTCATTGAGGATTAAATTTGGACTCATTTTTGTTATCACCACTTAGAAACATGCTA
GAGAAGAAAATAAATCATATTTAGGGATCTAAAGGGGCCGTTTGGTCGAAAGTATTAGAA
CAATAATGCATGCATTAGTTGTGTATTACTAGTACCTTGTTTGGTACACTTTTTCAACCT
ATGTATAAG