Microarray Probes on PGSC0003DMT400062634

Probe IDChipProbe Sequence
CUST_50939_PI426222305 JHI_St_60k_v1 GTTAATGAAGTTGCCTCTTAATCACAACTTCTCTTGGACTTTTCTGCATGAGATTTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062634

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062634 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38200.1 +3 6e-26 103 50/80 (63%) Class I glutamine amidotransferase-like superfamily protein | chr5:15256383-15258474 FORWARD LENGTH=436

Transcript Sequence (542 bp)

>PGSC0003DMT400062634 542 pgsc_dm_v3.4
CACGATTAACCTTACGCTCACCATTTATATAACTTATATACTAATCCTTGATTGTGGTTG
ATTATGTAATATTGTAGTCAAATACAGCATTGAGTATCCAACAAGAGACAAGGTTAATTA
AGATGGGAGCCACAGTAAGAAATGGATGTTCTTACTTAGAGAAATTAAAGATGAATGAGG
AGAGAGAAGGGTTAGCTAGAAAGATAATGGGGAAAATGTCTGTGGAACAATTATCAGATC
TCAAGTCTTTCTACAACATGATGGGACAAATATGTTGTGAAGTATTAGAAAGAAAACTAC
AAGATATTGTTAATGAAGTTGCCTCTTAATCACAACTTCTCTTGGACTTTTCTGCATGAG
ATTTTGTTTTTTATTGCTTTGTTGTCAAGTTTTATGTACTTTTTTTTTGTGACATCTCAT
GAATGGAAGTTAGTTTCTTTTTCTCTCTTTTAAGAGAATCACATGTATGCAAAAATTAGT
CAAAGTGTGTGTAAGAGAAAATGACAAAAATATATATACTAGTTTTTTTATATTGAGACG
GA