Microarray Probes on PGSC0003DMT400062617

Probe IDChipProbe Sequence
CUST_32882_PI426222305 JHI_St_60k_v1 CCAAAGATTCAGAAATCATATACACATGGCTAGTGTTGAAGCAAGACATCTCAATCTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062617

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062617 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G12920.1 +3 2e-75 240 142/316 (45%) SBP (S-ribonuclease binding protein) family protein | chr3:4122127-4123323 REVERSE LENGTH=335

Transcript Sequence (1185 bp)

>PGSC0003DMT400062617 1185 pgsc_dm_v3.4
GGGCACTGCCCATTCTTCCCTCTCTACTTCCCCCAACTCCATTTGCATGCTCTCTCTCCT
CTCATCTCCTTCTTTAACAACCCATAAGCCAAAGATTCAGAAATCATATACACATGGCTA
GTGTTGAAGCAAGACATCTCAATCTTTTAAATCAACAAAGGAATTTGATAAATTCGAATG
GATTTGTATACAATACCCAGATGAGTTCAGGACTGTTGCCAATGCCGGAGAATTATTTGC
CGATTCAGATTCAGCCCAAGACGTCGGTGAATACTGAGAGTGGTCTTACCTTCAACCTGC
CCACAAATGATGTAGTCGCTCCAAGGAAACGTTCAAGAGATTCATTCACTCCTTCTTTCT
CTACCCCTCAGAAACCCTGCAACGGACTCTCTCAAATTCCATCGTTTGTCGGTGATGATG
TTTTGCCACTTGTTCAACAGTATCAGTTGGATATCAATTCCATCATTTCTCACCATACGA
AGAAAATAAGATTGGAATTAGAAGAGCAACAGAAATATCAATCGAGAATGCTGGTATCAG
CAATTAGCGAAAGAGTAATGAAGAAAATGAAGGAAAAAGACGAACAAATACAGAGAATAG
GAAAAATCAACTTAGTCCTACAAGAAAGAGTAAAAACTCTTTACATGGAAAATCAACTAT
GGAGAGACTTAGCACAAGCCAACGAAGCCACCGCCAATTCACTCCGCAGCAACTTAGAAC
AGGTCCTGGCACACGTTACCGAAGAACGCCTCTCCGCCGAGGAAGACGCCGAGTCATGCT
GCGGCAGCAACAACGAAGAGGATGATAAAGAAGAAGAAGTGCGCACGTTAGCGGGAGATG
CGCAGGATAAGAGAAACAGAATGTGCAGAAGGTGTGGAGAGAGGGAATCATGTGTATTGC
TGTTACCGTGCAGACACTTGTGTTTATGCACAGTTTGTGGGTCAAGTTTACAGGATGCTT
GCCCAGTGTGTAATTCGAATATGAATGCCACAGTTCATGTGAACATGTCTTCTTGATCCA
TCCATGGAAATCTTCAACAATCAAGATTAGACAAAATAGAGTTACAGGTTACTGTAAATT
CACTTTTGGTACTAGTAAATGAATTGTTCATTCTTTCTCTATACATATTCTTTCACTTCT
TCTTGAAATTTATTGTTCAAGACAATTCTTAAATATTTATTCAGG