Microarray Probes on PGSC0003DMT400062174

Probe IDChipProbe Sequence
CUST_33971_PI426222305 JHI_St_60k_v1 TTGACAGTAATTGGGTACCAACACCAAGCTGATGTAGATGCTGGAGGTGATGTATGTGGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062174

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062174 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G37170.1 +1 1e-160 456 236/286 (83%) plasma membrane intrinsic protein 2 | chr2:15613624-15614791 REVERSE LENGTH=285

Transcript Sequence (1111 bp)

>PGSC0003DMT400062174 1111 pgsc_dm_v3.4
TCCATTTGCACTCACTTCTCATCAAATCAAAACAATTTCTCTCTCTTTAGCAAAGGAAAG
ATGACTAAAGAAGTTGAATCAGTAACAGAAAGAGGAGAGTTTTCAGCAAAAGACTATACT
GACCCTCCACCAGCACCATTAGTAGACTTTGAAGAACTAACACAATGGTCATTTTACAGG
GCAATTATTGCTGAATTTATAGCCACTTTGTTGTTCCTTTATATTACTATTTTGACAGTA
ATTGGGTACCAACACCAAGCTGATGTAGATGCTGGAGGTGATGTATGTGGTGGAGTTGGT
ATTCTTGGTATTGCTTGGGCTTTTGGTGGCATGATTTTCATTCTTGTCTACTGCACCGCC
GGTATCTCTGGAGGACACATCAACCCAGCAGTGACATTTGGACTTTTTTTGGCAAGAAAA
GTATCACTAATCAGGGCAGTATTGTACATGGTAGCACAATGTTTGGGTGCTATTTGTGGT
GTTGGTTTTGTCAAGGCTTTCCAATCAGCTTACTACAATAGATATGGTGGTGGTGTTAAT
GTCATGGCTGCTGGTCATAACAAGGGTGTTGGATTAGGTGCTGAAATCATTGGTACCTTT
GTTTTGGTCTACACTGTCTTCTCTGCCACCGACCCCAAGAGAAACGCCAGAGACTCCCAC
GTACCCGTGTTGGCACCACTTCCAATTGGATTTGCTGTGTTCATGGTACATTTAGCCACT
ATCCCAATTACTGGAACTGGCATTAATCCAGCAAGGAGTTTTGGTGCTGCTGTTATTTAC
AATGGTGATAAGGCGTGGGACGAACACTGGATTTTCTGGGTTGGTCCATTTATTGGAGCG
TTCATCGCTGCCTTCTACCACCAGTTTGTCCTCCGTGCAGGCGCAATTAAAGCTCTAGGT
TCATTCAGGAGCAATGCCTGATTTCAAATTTCATCAATCCAATGAATAAGAAGAAGAAAA
AAATTTGTACATAATTAAGAAGAAGAAAAAAAAGTGTTTGTTTCTTTATCCTATGAATTC
CCCTTTCTCTTTTGTGTATTTGTTTTTTCATCTAATCTTGTTTGTATCTTTGAATTATTA
TTAAAGTTAATGTTGTCTTGCAAAGTTTAAG