Microarray Probes on PGSC0003DMT400062149

Probe IDChipProbe Sequence
CUST_16228_PI426222305 JHI_St_60k_v1 CTTTTAGATCAAATGTAACAATTTCAAGTACTGCTTCCTCTCCTGGCTACACCTTAAGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062149

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062149 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G02500.1 +3 3e-64 214 136/308 (44%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16030.1); Has 49 Blast hits to 49 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:519364-521628 FORWARD LENGTH=293

Transcript Sequence (1698 bp)

>PGSC0003DMT400062149 1698 pgsc_dm_v3.4
TTTCCTTCCCACCCGGGTCCAGTATCCGTAGTGGGCTCTGATTAAGTCTGGATAGGCACA
TTGCAAGACTCATTTTTGTGAGCGACACTCCTAATATGATTTTTTTAATTCTTAAGGTGA
AATAATCGTAATCATCCCACCAAAACTCCTGCACGTATAGTTTGTAGACATATAGTAGCA
GTACTTCAGCTCCTAAATTAGGTACTGTTTCTTTACACTTTCAGTGTATATAAAGCAAAC
CCTTACAACAATTATTTATCATAGTCCCCTGCATTTTTTTTTAATGCAAAAGCAAGAAAA
TCAGATTAGAGCTCTGTCTGATCTTGCTACTTGCAGATAAACCAAATATTTCATGTGGCC
CAATTTTTAGTTCTTTTTTTTTTCATTGACCAATTTCATTTAAACATGGCATTATAATTT
TTTTTTTAAAAAGTTGAAGTGTCATCAAAGTGTTCATTACCAACATGGAACAATCAAGAA
AACAAGATGAATCAGAGTTCAACTTAAGGGAATGGGCTCTTAAGGCTAAACTAAACAGAG
AAAAAACCAATTCAAGAAGGTACTCTGCATCTTATATTAGAAGTTTTAGAGAAGAGGCAA
AATCTTTTAGATCAAATGTAACAATTTCAAGTACTGCTTCCTCTCCTGGCTACACCTTAA
GAGAGGAAATTGATCCATCAAAATATTCTTTTACCACTGCCCTCAAAGCATTACAGGCAA
AAACAATATATAGTTGGGAATACATGTCACCAGATGGTTTGGCTTTGAATTCGAAATGGA
ATGAAGCTGAGAAATATATATGTAATCCATTGTCAGGGGAAGTTCCTTTAGAATGTTTGT
CTGCAAAAATACTAAGTGGAAGATCATTTAGACAACCATCAAGCAGAATTACTATTTCAG
GTCCTCTTATTTATCCTTCTCAGATTCAGAGTACACCACAAGTCCAAACAAAGCACCATG
TGAAAAAACCTTCTTTTTCTACACATGAAGAAGTTGAAATCAAAATCCCAACCAAAGAGA
AGAAAGAAGTTAGCATTACAAGAGATGTGGGAACACAGAGCATTTCAGCTTATGTAAGTT
CAAGTAGTCCAAGTCCTGCTCCAACTCCATCAATTGAAGAAATGTCTATGAAGCTAAGTG
AAGCAGCTGACTCCTCAACTATGACTACTCCATCCATTAAAGAAATTTCCTCAGATCACT
CTCCTGTCACTACTCCTAAATTAAAATCTGAGCAAGAGGTGGAAATGAAAGAAATAGGAG
AAGAAGACACAAAAAGAAATGAAGAAATTCAAGAAGAAGGAGAGAGAAAGAAAGTGAAAT
TGGGTGGGGGGTGTTTGTCATGGAAGAGTTTGTGGATGAGAAGAACAAGGCAGAGAGAGA
AGCATAAATCAAGAAACAACAACATTTTTCTTTGCCATATAAATGGATGTTATAAACACT
AAAATTCAAAAAATAATAAAAAAAAAACATGTCCTTGGGGATAGAAAGATTCTCTTTCCA
TCACACCCTTTGTCTATTCTTAGATTCTAGTATATCTACCAAGGATCTATAAAACATGCA
TGTCTATTCTAATATCTTGTCATGAACATTTTTTTATAGAGCTTTAAATTATCTTGATTC
CTTTTATTTGTATTAAATATTTTGACTAAGAACCAGATTTTTGTAGTCTTCCCGAATAAT
TACTTCTTTATTTTTATT