Microarray Probes on PGSC0003DMT400062093

Probe IDChipProbe Sequence
CUST_50499_PI426222305 JHI_St_60k_v1 GCACATCACATCCGATGAATATCCTTTGTTTATTAGTCCACTTGTTCCATATTATCTGTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062093

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062093 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G17550.1 +2 0.0 717 388/548 (71%) Major facilitator superfamily protein | chr4:9777938-9779738 REVERSE LENGTH=544

Transcript Sequence (2507 bp)

>PGSC0003DMT400062093 2507 pgsc_dm_v3.4
TACCTTATACACTCTTGAAAAAATAAAAAAACATAGTTGAGCTTCAATGCTAATATGAAT
ACTTAGACCTTGTTTCGGTTCCCCTAACTGTTTGGCGTGGCTCCTGGCCAGAATTTCAAA
TCCTTGTAAGACGGACACGCAACTATTCCCTTCCTTCACGTCATCACTCTCTCTCTCTCC
GGCCACCCTCCATTTTCTCTATCAAAGCTCTCTCTCACACAGTTGGAGGAATTATGGGTG
AACTCCCCAATCTGAACCCGTTTCAGTAAATTTCCTAATATCACTTCCAGATCTTTCTTT
CTGCAGAAAAATAAAAAATAAAAAATTATCAGTCCAGAAAATTAGAAATTTGCATTGATT
TTTTTTTATTCTAGTTTTTTTTTTTTTGAGAATGGCAGAGAATAATGATTCAATGAATGC
AAACCCACCTGGGATTTTGCTAATTAGAAGCATTAGAAGGAAAGATTGGAGTTTAAAAAC
GTATAAATATGTAGTTTTGTTGATCACATTCATAGCTTATACATCTTACCATGCTTCGAG
AAAACCTAGTAGTATTGTGAAGAGTGTTTTACATCCACACTCGTTTCTAAACGAAACGGT
TACAAATCCATGGCCTATTGGTCCGCTTTTCGTAAAGAGGGAATTTTTGGGCTCTATTGA
TTTAGGTGAATCAAAAAAGAAAGGTTGGGAACCATTTAATGGAGAGGATGGAACGTCGAA
ATTGGGGGAAATTGATGTTGCGTTTCTAGCGTGTTATTCGATGGGAATGTATGTAGCTGG
ACATTTAGGGGATTCATTGGATTTAAGGCTGTTTTTAGCAACTGGGATGATTGGAAGTGG
CATTTTTGTAGGGTTATTTGGTATGGGTTATTTTTGGAATATACATGCTTTTTGGTTTTA
CTTAGTTATGCAAATGGTTGCTGGGTTGTTTCAGGCTACTGGGTGGCCTTCTGTTGTTGC
TGTTATTGGAAATTGGTTTGGTAAAAGGAAAAGGGGATTGATTATGGGTATTTGGAATGC
TCATACCTCTGTTGGGAATATTAGTGGATCTCTTATGGCTGCTGCAGTTTTGGAATATGG
ATGGGGTTGGTCTTTTATTTTTCCAGGAGCATTTATATTTTTAGCGGGGATAATGGTGTA
CTTGTTATTGCCTGCATATCCAGAAGATGTTGGGTTTCCTTGTCCTAATCAGCCATATGT
TGAGGATTCATCCAAGACTAACGATGAAGAAGCTCAGACAGTGAAAGAAAATGTGGCGGT
AAATGCACAGCTTAATGTCCCTCGGGTTGGTTCGAATAGGACAAGTGTTGGTCTTTGTGA
TGCTTGTCTCATACCAGGAGTGATTCCATTTGCACTGTGCCTTTTCTTCTCAAAGTTGGT
GGCATACACATTTTTGTACTGGTTGCCATTTTACCTTAGTCAAACAGCTATAGGGGGAGA
GTATGTTTCAGTGAAATCTGCTGGGAATCTCTCTGCTCTGTTTGATGTTGGAGGTATAGT
TGGTGGAATTCTAGCTGGACATTTGTCTGACAAGCTTGATGCTCGTGCTACTACAGCAGC
CAGCTTCATGTATGCAGCGATTCCTTCTATGCTTCTGTATCGCAAATATGGAGGCACATC
AAGGCTCATGAACATTTTGCTCATGATGATTGCTGGCTTGTTTGTTAATGGGCCTTATGC
ACTTATAACAACTGCAGTGTCAGCAGATTTGGGTACTCACAGCTCTTTGAAAGGAGATTC
ACGAGCACTTGCAACAGTTACTGCCATAATTGATGGTACTGGATCTATGGGTGCTGCTTT
AGGTCCTCTTTTGACGGGTTTTCTTTCATCAAAAGGATGGGATGCAGTTTTTATAATGCT
TGTTGTTGGTGCACTTAGTGCTGGTCTTCTTCTATCTCGTTTGGTTCTTTCTGAACTTAG
TGAGAAGTTCTCTAAGCGCCTAGCCTGTGAGCAACACAATAGCGAAGATTCTGCATCTCA
ACCCCTTCTAAGAGACCGAAGATGAGGATTTGTTGTGCATGTTTTCTCAAGAAACATAAA
GAAATGATGGCAGATACAAGTACTACCTCTCTGTGAAAACAGAAGCAAAATCTTAGGTAT
GAAAAAGCCAATGGAATCAGTGGGACTCAACAAGCCACTTTGTCATCAAAATCGCCACTA
ATGCCTTGAACATGGTTTCTTAGTACATGTCTAAATGAACAAAGGTGCTTCTCTTATGAG
GTTTTTCTCTTGTGAAAATCGCTGCTTTTTATCTGAGATATATTTAAGGTTTAACGAGAC
GTGTCTGGTAGTTATGCTGCTGCTGATATTACCTTTCTTCTTATCCCATGAAGCAGAGTT
GTAGATAGAATAAAGTGAAGCTAGATTGTTAGATTTAGTAGCACATCACATCCGATGAAT
ATCCTTTGTTTATTAGTCCACTTGTTCCATATTATCTGTCTATTAAAATTTTTGCTGCAC
AAGTCTTACTCATAATAAAATTTGTGTAAACCACCTTTTGTTTCTTC