Microarray Probes on PGSC0003DMT400062084

Probe IDChipProbe Sequence
CUST_50510_PI426222305 JHI_St_60k_v1 GGACTCGCTTGGCCATGAGAATTATTCACTTTTTGGAATAATTTCTCGTTTTACAGAAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400062084

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400062084 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G16820.1 +1 0.0 557 309/509 (61%) alpha/beta-Hydrolases superfamily protein | chr4:9467563-9469116 FORWARD LENGTH=517

Transcript Sequence (1821 bp)

>PGSC0003DMT400062084 1821 pgsc_dm_v3.4
TAACAACTAACTCATTGACTCTTGTCTCTCACTCTCTAAATCCCTCCACCTTTTTCTCTC
TCTAAAACCATGCAGATCGGAACAACACTTCCAAATCTTCACCTTTTTCAGCCAAAGGGA
GTCAACTTTAAGTGCAATGCACAAACTGTAAAAACAATCTCATCATCTACAGAAATGACG
AAAAAACACATTTCCAATCTCGAAAAGCTTCTGCAAAAGACGAACCCAATTGATTCATCG
AAACCTGTAATTGAACAATCCAGTAATAGGTCGATAGAGAATAGAAGAAAAAACTTGTTA
GAAGGGCTCAATTTGGCTAACATTTGGCCTGATGAGATGAGAAAAGCTGCAGAGGATATG
TCGCCACGGCATTTGAATAGACTAAAAAGACTATTATCTTCAAAATCAATTGAATATTCT
CCTCGGAACAATCTCGCTAACCGGTGGAGAGAGTATCACGGCAGCAATAACTGGCTCGGG
CTACTCGATCCGCTCGACGAAAATCTCCGGCGAGAATTAGTCCGGTACGGGGAATTCATA
CAGTCGGCTTATCACTGTTTTCACTCCGACCCGGCCACGTCAGCAGATGAGGTTCCATCG
GAGAGACACGTGGCGTTGCCCGATAGGTCATACAAGGTGACTAAGAGCTTATACGCAACT
TCGTCTATTGGGTTGCCTAAGTGGGTGGATGACGTGGCACCTGATCTCGGATGGATGACT
CAGCGGTCTAGCTGGATCGGTTACGTGGCAGTGTGCGATGACAGGAGTGAGATCCAACGA
ATGGGAAGGAGAGACATTGTTATCGCGTTACGAGGGACCGCCACTTGTTTAGAGTGGGCA
GAGAATTTTCGTGACTTGTTAGTGGAGCAAAATGATAATGATGATGATAACGACGAAGGA
GTAGTACAGTCTAAAGTAGAATGTGGATTTTTAAGTTTATACAAAACAGGTGATCATCGT
GTGCCAAGTTTAGCTGAATCAGTTGTTAACGAAGTGCAAAGATTAATCGAAAAATACAAA
GGCGAGCCTTTAAGCATTACCGTAACCGGGCACAGTCTCGGTGCGGCATTATCCCTTTTG
GTCGCGGATGATTTAAGCACGTGCGTGCCGAACGCCCCGCCCGTGGCCGTTTTTTCCTTC
GGGGGGCCACGAGTAGGCAACCGGGGTTTCGCGGATCGACTTAACGATAATAATGTTAAG
GTTTTACGTATCGTGAATAATCAAGACGTGATTACGAGGGTTCCAGGAATGTTTGTGAGC
GAATCACTCGACAAAAAGTTAAGAGAATCGGGTGCGGGTCGACTGCTAGAGATGTTAGAT
TGTAGGATGCCATGGGCGTACTCACATGTTGGGACTGAATTCAGAGTTGATACAAAGATG
TCTCCTTTTTTGAAGCCTAACGCGGATGTTGCGTGCTGCCATGATTTAGAGGCGTATTTG
CATTTGGTGGATGGATTTACGGCATCTAATTGTCCATTTAGGCCTAATGCCAAGAGAAGT
CTTGTGAGGCTGCTAAATGAACAAAGGTCTAATTTTAAAAGACTTTACACTAGCAAGGGA
AAGGATTTGACTATCAATCTTGATAGAGAACATAATTTCCCTAGATCTAGTTGTTTGCCT
AGTCCATCATCCTGAGTATACTTCATGTACAAAGAAGTAACAAGATGTATATGTTTTCGA
CATACTTGTTTTTCTCTTTTTTAGGACTCGCTTGGCCATGAGAATTATTCACTTTTTGGA
ATAATTTCTCGTTTTACAGAAATATTAGTGTTTGGCCATGGAAATTTCAAATTAAACTTG
AAGTTGAATTCCAAATTTTTC