Microarray Probes on PGSC0003DMT400061938

Probe IDChipProbe Sequence
CUST_37073_PI426222305 JHI_St_60k_v1 TTTACTTGGTCCTATGGGGAAAGAATAGAGAAGCAGAGAGGGAAATAGTGGAAATCAAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061938

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061938 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G43650.1 +1 8e-65 209 100/187 (53%) nodulin MtN21 /EamA-like transporter family protein | chr1:16443861-16446814 REVERSE LENGTH=343

Transcript Sequence (852 bp)

>PGSC0003DMT400061938 852 pgsc_dm_v3.4
ATGTCAATGGAAAAGCAAAAGCACTACATTGCCATGCTCCTCACACAAGCTATTTTTGCA
GGCATGGCTTTGCTTTCTAAATCTGCAATATCTCAAGGGATGAACCCTTATGTTTTTGTG
ACTTATCGTCAATCATTTGCTATCATCGCGTTAGCCCCCCTCGCTGCCTTCTTTGAAAGA
GTGGAGGCTCTTGCAATAAAGAAGTCACATGGAATGGCAAAATTGTTGGGTTCTTCAATT
GGTGTTACAGGAGCTTTGGTATTTGCCTTAGTTAAAGGTCCACAATTGAACTTCATGAAT
TGGTTCAAAGGGAACACAAGGGGAACTCATAGCTCAAATTTGAATTATAGTTTGAAGGAA
GAGTGGTTAAAAGGTTCACTAGTCATGGTTTTGGCCAACATTACATGGTCTCTATGGCTC
ATTTTACAGGTTCCTATTGTGAAACAATATCCAGCAAAGCTTCGTCTTGCCACTCTATAT
TGCTTGTTTAGCTGGATACAATCTTCAATTTGGGCCATGGTGATGGAAAGGAATATATCA
GCATGGAAGCTAAAATGGGACATTAATCTTTTTTCAGTAGCTTACTGTGGTTTGATTGTT
ACAGGTTTGACATATTGGATACAACTTTGGACTGTAGAGAAGAAAGGGCCAGTATTTATA
TCTATGTTCACTCCATTATCACTCATCATAACTGCCATAGTGTCAGCATTTTTGTGGAAG
GAAACACTTTATGTGGGAAGTGTATGTGGAGGAATATTGCTAGTTGGTGGGCTTTACTTG
GTCCTATGGGGAAAGAATAGAGAAGCAGAGAGGGAAATAGTGGAAATCAAGGATGGAATT
ACAGTAATTTAA