Microarray Probes on PGSC0003DMT400061873

Probe IDChipProbe Sequence
CUST_8952_PI426222305 JHI_St_60k_v1 GGTAGGTGGCGAATGTATGAGTTGTGACATTTGAAATTGTTTTGGTTATCAAAAGATGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061873

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061873 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G56550.1 +2 3e-13 67 36/69 (52%) oxidative stress 3 | chr5:22895847-22896502 REVERSE LENGTH=172

Transcript Sequence (1066 bp)

>PGSC0003DMT400061873 1066 pgsc_dm_v3.4
TTTTCCCCTTATCTTGTTTCACCTATTCATTCACATAGAAAGTACCAAAAGAGGAAAATT
GCATTATTTTTTTTCAAGAACTGTATGGTGGATTTTGTTTGTTTAGATTATGAATGTGAA
AATGAGATTAGTTTCTTTGGACCAACAAAACAACCATGGGATCATGGATGAGGAAAATCA
TGATTCTGATTCTTCTGATATTTTGAGTAATTTCTCTTCATCTGATTCGGAGTTGCTTGG
CGAAGAAGAAGAAGAAGGAGAAGGGGATTCTTCAGATCCGACTTCTCCGAATTCTTCTTC
TTCTGGTGATTCAATAAGTCATGATGAACACACAAAAGGAGCTTTGCAAAATATGTCCAC
TCTTCTTCAAGAACTTCCCTTCAAGAGAGGCTTGTCAAAACACTACAATGGGAAATCACA
ATCATTCACCTCTCTATCAAATGTGAGAAGCTTAGAGGACATGGCTAAGCCAGAAAATCC
ATACAACAAGAAGCTCAAATCATGCAAGAGTTATGGAGTTTTCTTAGAAGGTTTCAAATC
AAATAACCTGCATCCTCCTATTAGAAGCAATAGTTCTTCAAGACTAAGCTCAAAGAGAGG
CTCATGTTCATCATTAAGAGCAAAGAGAAATGGAAGCTTTCTTGGGAATAATAGTAGACC
TCCTGCTCCTCCACATAGATCAACTAGTTTTACAAATCAAACCCCTTTGTTTGCTTGATG
GTTCTTATCAAAAAATATTTAAAAGGATTTACTAAATGTATTTACTTTGTTGTTGTTACT
GTTTCTTTTTTCAGCTGGATGCTATGTGATGCTTTCTGTAGTACTTGTTATATTTATTTT
TTATGTTCTTTGATATGTGTTACCTGAGTCGGATAGAGGCATACTTCTGTCCTTACTTGA
TTCCATCATGTGGACTTCATTGAGTATGTTTATGTTGTTGTATTTTGTGTTCGAAGTTCC
ATACTTAAATTGGATCTTGCTTGTTTTATTTAAACGGTAGGTAGGTGGCGAATGTATGAG
TTGTGACATTTGAAATTGTTTTGGTTATCAAAAGATGATTTAATCT