Microarray Probes on PGSC0003DMT400061845

Probe IDChipProbe Sequence
CUST_9059_PI426222305 JHI_St_60k_v1 CCTATTGCATATGCAAAATCTCTTGTGCCTCCTACAAGAACTATCTCTCTTCTAAGCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061845

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061845 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G17230.3 +1 0.0 530 284/432 (66%) PHYTOENE SYNTHASE | chr5:5659839-5662087 REVERSE LENGTH=437

Transcript Sequence (1188 bp)

>PGSC0003DMT400061845 1188 pgsc_dm_v3.4
ATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGAGGTCTCAAATGGGACAGGATTC
TTGGAATCCGTCCGGGAGGGAAAAAGTTTTTTTGATTCATCGAGGCATAGGAATTTGGTG
TCCAATGAGAGAATCAATAGAGGTGGTGGAAAACAAACTAATAATGGACGGAAATTTTCT
GTACGGTCTGCTATTGTGGCTACTCCATCTGGAGAACGAACGATGACATCGGAACAGATG
GTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAGCTGAGATCTACCGAT
GAGTTAGAAGTGAAGCCAGACATACCTGTTCCTGGGAATTTGGGCTTGTTAAGTGAAGCA
TATGATAGGTGTGGTGAAGTATGTGCAGAGTACGCTAAGACGTTTAACTTAGTATGGTGC
AGGAGAACAGATGAACTTGTTGATGGCCCGAATGCATCATATATTACACCGGCAGCCTTA
GATAGGTGGGAAGATAGACTAGAAGATGTTTTCAATGGGCGGCCATTTGACATGCTCGAT
GGTGCTTTGTCCGATACAGTTTCCAACTTTCCAGTTGATATTCAGCCATTCAGAGATATG
ATTGAAGGAATGCGTATGGACTTGAGGAAGTCGAGATACAAAAACTTTGACGAACTATAT
CTCTATTGTTATTATGTTGCTGGTACGGTTGGGTTGATGAGTGTTCCAATTATGGGTATC
GCACCTGAATCAAAGGCAACAACAGAGAGTGTATATAATGCTGCTTTGGCTTTGGGGATC
GCAAATCAATTAACCAACATACTCAGAGATGTTGGAGAAGATGCCAGAAGAGGAAGAGTC
TACTTGCCTCAAGACGAATTAGCACAGGCAGGTCTATCCGATGAAGACATATTTGCTGGA
AGGGTGACCGATAAATGGAGAATATTTATGAAGAAGCAAATCCATAGGGCAAGAAAGTTC
TTTGATGATGCAGAGAAAGGAGTGACAGAATTAAGCGCAGCTAGTAGATTCCCTGTATGG
GCATCTTTGGTCTTGTACCGCAAGATTCTCGACGAGATTGAAGCCAATGACTACAACAAC
TTCACAAGGAGAGCTTATGTGAGCAAATCAAAGAAGTTGATTGCATTACCTATTGCATAT
GCAAAATCTCTTGTGCCTCCTACAAGAACTATCTCTCTTCTAAGCTAA