Microarray Probes on PGSC0003DMT400061791

Probe IDChipProbe Sequence
CUST_25987_PI426222305 JHI_St_60k_v1 GGCCTCTTATTGGAACATGATTCATATATACAGTTCCCTTTCCCCTTGATAGTTAATATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400061791

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400061791 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G06350.1 +2 5e-50 187 116/201 (58%) dehydroquinate dehydratase, putative / shikimate dehydrogenase, putative | chr3:1924536-1927701 REVERSE LENGTH=603

Transcript Sequence (2885 bp)

>PGSC0003DMT400061791 2885 pgsc_dm_v3.4
GTTTTTAATACTAGCATACCACTCATTCAAACACCAAAAGAATTTGCTAAGCGCACATGT
ATTGTCTTCCGTCCCCTATATAAGAATAAGAGAGTCGTAGCTCTCGGAACATTATTATGG
GTTTGAAGCATGACTTGGTGGTGTACACAAGACTAGAGTGTGAAAGCTGTGAGGAAATGG
CAGCTTCTATGCACAAAGCTAAAGAAGAAGGAGCAGATCTGGTGGAGCTTTGCATTGATG
ACTTCACTTTCTCTCACATTTCACAACTTGAACTACTACTCAAACAAAGAAGTTTACCAT
CCATCGTTTCTTTCAGGCCAAACTCTGCGATAAATTCTGACTGGAAGAAAACATGTATCC
AAGTTCTCAAATTAGCTGTTGAATTGGACGTTGAGTTCGTCGAAGTCGACACTGAGGTTG
TTTCCCATCAAGTGGTTGCTGAATTGATGAGCAGCCGATCAAATAGCAAGATAATTGCTT
CTACGTATGTCATTAATGCTGGAAACCCTCCTACTAAAGACGCACTTTGTAATTCCATCA
TAAACCTGCAGTCCACAGGAGCAGATATCATCAAACTTGTCATTGATGTAGCTTATATTA
CAGATGTTGCACCAGTTTTCCATATGCTTACACATTCTCAGCTCCCTCTAATTGCTAGGG
CAGCAGGGGATAGAGGTCTTATAAGCCAACTATTGGGTCCAAAATACGGTGCTTTCTTTG
TTTGTGGATCTTTGGCAGGCAAATCCACCCCTGGCTTGCCTCCTTTGACCAGCATTAAAC
AGGTTTATAAACTCCAATATGTCAACCCAGATACTAGAGTTTTTGGTGTAATCTCAAATC
CTGTTGGCCATAGCAAGGGCCCCCTTCTGCACAACCCTGCCTTTAGGCATACAGGATACA
ATGGAATATATGTCCCACTACTAGTTGACAATGTCAAGGAATTTTTTCGCGTTTTCTCAT
GTAATGACTATGCTGGTTTCAGGTACGCTACCTCCTTCTGCACTAAGTATTGTTTTTTCT
AAAATTATATTTGCTTCATGTAGAAAACTATCTAACGCAGAATCTTCTTCCTTTTGATGG
AACCTGTAGTGTTGGTATCCCACATAAGGAAGCAGCAGTACGCTGCTGTGATGAAGTTGA
TCCACTTGCTAAGGTTTGATTAGCTCCATGTTTGATGAGTGCATATGTTGTGTAACTTAC
CTTCGGGTTTTGGGAGTTAAAGAACCCGAAAAAGCACAAACTTTTCGGAATGTCTTTGCT
GAAGCTAGTTCAGCATCAATACTTCTTATATAATGACAACTTTGTTTATATATGTGTACA
GAGGCCACCTGCATATACACATAGGAAACGAAAGCTTACCTTCTTTATGTGCTTGAATCA
CCCTAGAATATTAGGCACAATATTATCAGTTTTATTTTCCATGAATCGACTAATGAATAA
CTAGCCTTAGTCCACCACGGGTCAATGTTGAAGGAAGCCTAAGTAGAGATATTACCCTGG
TTGGGTAATAAATAGGTCTAGCAGCATCAACTTATGAAAAGAAAACAAGTTGTGTTTCTC
TTCCATATATTCTCAACATGACAATTCTTTCTTATGTGATTGCAGTTCACATGGACTAGA
ATGCTATTGTCCTTGCATGGAAGCAGAATTTGTTATATAGATTGGCTCTGTATCTTGAAA
GTTCAGATGCCATAATAGTTCTTTTTGTTTAACCATTCCAGAACATTTTGTGGCTAAATT
ATATTACAGTGTTTGTTGTCTTGTTTTTAAACTTTCTAACTGTATCATGCTTCGGAATCA
GTCTATAGGAGCTGTAAACACAATTATAAGGAGGCCTTCTGACGGCAAGCTCATTGGTTA
TAATACAGATTGTGAGGCTTGTGTGACGGCAATTGAAGATGCACTTAGAGAGAGACAAAA
GACCAATGGCTGTGCATCAAATGTTTCTCCAATTGCTGGAAAATTGTTCGTATTAGTTGG
GGCAGGTGGTGCAGGGCGAGCTATTGCTTTTGGTGCCAAAAGCAGAGGGGCAAGGGTTGT
AATATTCAACCGCAAATATGAGAGAGCAAAAGCTCTGGCTGCAGCAGTATCCTGTGAAGC
TTTGCCATATGAACATCTGAACGATTTCTGCCCTGAGAAGGGAATGATTCTTGCAAATGC
TTCTGCTGTGGGCATGCAGCCAAAGTCTGATCAAACTCCTATCTCCAAGGAGGCCTTGAG
ATCATACGAACTAGTATTTGATGCAGTTTACACACCTAGAAATACACGGTTATTGCAGGA
GGCTACAGAGGTTGGAGCTACAGTGGTGAGTGGGGTTGAGATGTTTGTCAGGCAGGCACT
TGGGCAGTTTAAATTGTTCACCAATGGATTAGCACCAGTAGATTTTATGCGGAGGATTGT
GTATGAGCAATTTTGATTCTTTTAGAAGAAAGATATAGTTTCTGAAATCAGGCAGTGCTA
GCTAAAACCAGGATCATATTTGCCAACTCAATAGAAGAGGTTTCTGAAATTCATATTGAT
GCTTCCAAATGCCAAATTGATTTACATGGGACGAAGGATATATCAAATACCGTAAAAGTA
GTTTACTTTTTCTTCCTATGATTGTAATAATAGGAAGGTAATTATGTCAGGAAACATGTC
TTTATCCCAGAAAGGTGGTTTATAAGCAGTAACAAAAATTTGCCTAGCCTGGAACAGTTG
AGCATTCTTTCGAGATATATACTTGTTATCTGGCACCAGTGTTAGCTGTCCATTTTTAGA
TCATAAAAATAAGACATACAAATTTGATTAGAGCAAAATTGGACAATTGGCCTCTTATTG
GAACATGATTCATATATACAGTTCCCTTTCCCCTTGATAGTTAATATATACTATCATGAA
TCAAT