Microarray Probes on PGSC0003DMT400060674

Probe IDChipProbe Sequence
CUST_16400_PI426222305 JHI_St_60k_v1 GATTGAAGATGGATCGGATAAAGGGAAGGAATTTGCAGTGATGACTCTTTTGCAGCTATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060674

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060674 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G16490.1 +2 0.0 540 306/443 (69%) ARM repeat superfamily protein | chr4:9293891-9295530 REVERSE LENGTH=472

Transcript Sequence (2260 bp)

>PGSC0003DMT400060674 2260 pgsc_dm_v3.4
TATAAATCCACCATTTTCATCACTCATTCGAGTTCTCTCTCAGTTCCACTTTCTTCTCAA
ATTCCGCCATGAAAATTTCTTAAACCAACATAAAAAAACACCCTTTTCACCAAATCTAAC
AATTCTTCAAACACATTTGAAAACTCCATCGTTCTTGCTCTGTTTCTGAATTTCATTTCT
TCCCTTTTTATTCACAAATTCCGCCATGAAAATTTCTTAAAACCCATTAAAAGAGCCACC
CTTTTCTCCAAATCTGAGATTTCTGAACTCACATTTGACTAATTGAAACTCTGTTTTTGC
AAAGTTTCCAAATATGGTTTCGCTAGAAAATTCTCATTCTCATGTTTCTTCTACTACCCA
TTACTCCCAAACACGGCCTTATTACTATACTCCACCGCCGTCCTCCGCCAAAGTTCACCG
ACGTTCAATCGGCCGGTCCATGCGCACTATCCGGTCCAATTTGTACCAAACCGACTACGA
AAACTCCGGTCCGGTTTATGAGAACCTTACAGATTCCGTCGTTGATTTTCGCCTTACTGA
GCTAGCGAAGAAGCCGCCGGTTGATAAATCTTCTTTTTCCGATGTGGAATTTCTGGACAT
TTCCCATACTTTCAGTGATTTCTCGGCGTATAGCAGTGATATTTCCGGCGAGTTGGAACG
TTTAGCTTACATCCCAAATTCGGATCCGAATCAGAGTTCCGTTAGTGAACCCGAACCGGA
ACCGGAACCTTGTGTAGGGTTTCTGCAGCGGGAGACATTTTCGACAGAGATAATGGAAAG
CATTGAGCCGGAGGATCTTCAGCCGACGGTGAAACTCTGCGTCGACAGTTTACAGTCACC
GTCGGTTGCCGTGAAAAGATCGGCGGCGGAGAAATTGAGGTTTTTAGCTAAAAATCGAGC
TGATAATCGTGCTTTAATCGGAGAGTCTGGTGCTATTCCGGCATTGTTACCACTTCTCCG
GTGCTCCGATCCACGGACTCAGGAACACGCTGTAACAGCTCTTCTCAATCTGTCGCTTCA
CGAACCGAATAAAACCTTAATTACAAACTCCGGGGCGATAAAATCTTTGATTTACGTGTT
GAAAACGGGCACTGAAACTTCGAAACAGAATGCAGCTTGTGGGTTGCTAAGCTTAGCTTT
GATAGATGAGAATAAGTTATCCATTGGTGCTTGTGGTGCTATTGCCCCATTAGTGGCACT
GTTAATAAACGGGACGAATCGGGGAAAGAAGGATGCTCTAACGACGTTGTATAAGCTATG
CACGGTGAGATTGAATAAAGAACGGGCAGTGAGTGCTGGTGCTGTGAAACCATTGGTGGG
GTTAGTGTGTGAGGAGGGAACAGGGTTAGCTGAGAAGGCTATGGTGGTGTTAAGTAGCTT
AACGGGTATCGAGATGGGGCAAGAAAGTATAGTTGAGGAAGGAGGAATTGCTGCACTTGT
GGAAGTGATTGAAGATGGATCGGATAAAGGGAAGGAATTTGCAGTGATGACTCTTTTGCA
GCTATGTGTTGATAGTGTAAGGAATAGAGGACTTCTTGTTAGGGAAGGAGGAATCCCTCC
TCTCGTCGCCTTGTCGCAGACCGGAACTGCTAAAGCTAAGCACAAGGCAGAAACATTACT
GACATACTTGAGGGAATCAAGACAAGAAGCTTCTACTTCAACTCCTTAGCGAGGTAGCTT
AGATGGTCTTCTACATTTGAGTATTTTCTGTTTATAGGAAGTGATTTGAAGAGTTTGTAC
AGAGTGGTTTATAAATTTAAAAGTTCATAACATATGTCAAGGTAATCAAGAAAATAAATA
TCAAGTTAGTTTAAGGAAACTGACCTATTTAGGTAAATTTTTAACCAAGTTATTACATAG
GAGCTGGCAAGGGTGGTGGGAAGGGTTCTCATGTCCCTTTTGAATTATTATCTGTGAGGT
TGTTTGGTAAGAATTTGATAATGATCCCTTAGTTTTGTTTGGGTGGTCCTAATTCTTCTG
AAAGAGTTACTAATTTTCTGATTCTTTAGTGTGTAAAAAAGCTACTATTTCAGTATGCTT
TAGTCTTTTTTGGTTCTTGAACAATATGTCCAGTAATGAGATATTTTCTTGATTTTCTAT
GACTGAAATATGTCAAAGCTCAATTTTTTTCTTCAAGGTTGGGTTGTTGGCATTTTTACA
GCTATTAAATTTGTGTCTCCATCTATACAACTAGAAGAGTGTCAGATGTTTATATTTTCC
TTTGGTGTGAATACAGAGGGTATAGCAGCCCCACCTCTCC