Microarray Probes on PGSC0003DMT400060477

Probe IDChipProbe Sequence
CUST_14109_PI426222305 JHI_St_60k_v1 TTCGGGTCGTATGTTTCATACTTAACGGGTCACGTTTTCATATGTAATATTCATCCATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060477

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060477 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G55390.1 +3 1e-65 207 123/203 (61%) Uncharacterised protein family (UPF0497) | chr3:20534785-20535620 FORWARD LENGTH=194

Transcript Sequence (908 bp)

>PGSC0003DMT400060477 908 pgsc_dm_v3.4
TCATGAGAATCATGCCATGTCTCGTGACTTCAAATCCCCAAACAGAAAAAAAAACTTTTC
ACACATGAAATCAAATTTTCCAGAAAATTAATAAATTCACCCAACTTTAATTTCTCTATG
AATTTCTCCATCTCCGTCTGACTTTCTCGCCGGAAAAAATGATGAGGTCGCCGCAGGAAC
CGAACCGGAACGGCGGTATTAGAACTCCGTCTCCCCGGCCGAGAAATCAATCTCAGTTTC
ACTCAACCGTTTCCGTGCAAAAAAACCAGCGGTTCAATATTTTGATACTCATTTTCCGGT
TCGCCGCCTTCTGCTTCTCACTCGCCTCTGCAATTTTCATGTTCGCTAACTATCACGGCG
ATGGCTCCGATTCCGATACCGATTCTCTTCGGTGGTACCACTTCGATGCGTTCAGATTTG
TGGCAATTGCAGCTGGGATTGTAGCATTGTATTCACTATTCGAAATTGGAGCTTCGGTTT
GGGAAATATCAAGAGGCACCACTGTTCTTCCTGAAGTTGTACAAGTTTGGTTCGATTTCA
GCCACGATCAGGTTTTTGCATACATGTTGTTGTCGGCAGATTCAGCGGGAACGGCGTTAG
CTCGGACGTTAAGGGATCGGGACACGTGTACGGCTAATAATGCATTTTGTGTTCAATCAG
ATATATCCGTCGCCTTAGGATTCGCCGGGTTTATGTTCTTGAGTTTTTCTTCTTTATTAT
CGGGTTTTCGGGTCGTATGTTTCATACTTAACGGGTCACGTTTTCATATGTAATATTCAT
CCATCATTATGTTGTAATCTTTACTCATAAATCTTAATGAAGGTAAATTTTGATTTTAGT
CTCGTATCTGTATCTGACTAAACATATTGAACCTTCAAAATATGTTAATGCAATTCATAT
TTTTTTAG