Microarray Probes on PGSC0003DMT400060243

Probe IDChipProbe Sequence
CUST_14079_PI426222305 JHI_St_60k_v1 GCAAATACACAATGATTGAAGGGGATCCATTGGGACAAAATCTTGATTTTATTTCTCATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060243

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060243 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G45860.1 +2 7e-09 54 26/59 (44%) PYR1-like 11 | chr5:18604101-18604586 REVERSE LENGTH=161

Transcript Sequence (757 bp)

>PGSC0003DMT400060243 757 pgsc_dm_v3.4
AAATCATTAGTTTCTATTTAGCCACTAATTAAACTTTTAGTTCTAGTAGACCAATATTTG
ATTATTCATAATCATTATGGGTGTTACAACTTTTACTGAAGAAATTACTTCCCCTATAAC
ACCAATTCGTTTATTTAAGGCTTTAATTGTGGATTCAAAATCCTTAATACCAAAATTATT
GCCTCAATTTGTTGAAAATGTTGTTTTATTACAAGGAGATGGTGGAGCTGGAAGTATTGA
ACAAGTAAACTTCACAAAAGGTAATCCTTTTGAGTTTGTGAAACATAGAATAGATGAACT
AGATAAAGAAAATATGGTGTGCAAATACACAATGATTGAAGGGGATCCATTGGGACAAAA
TCTTGATTTTATTTCTCATGAAATAAAAATTGAAGAATCCAAAATTAATATTGGAGGATG
CATTTGCAAAATGACAACAAATTATCATGGAATTGGTGATTTTTTTGCCAAAGAAGAAGA
TATTAAAGATGGAAAAGATAGTGCTATGGGAATTTATAAAACTGTTGAAACCTACCTAAT
TCAAAATCCAAATCTTTATACTTAGTTAATAAATTAATTAAAATGAAGCCTATATGGTTT
GGTTCTTTTTTTTTTTAATAAATATTTTTGTTGTTGTTATTGAAGATCTGTAGCATTTCA
ACCATGCTATAAAAAAATTTGTATTCAATTGATGTAAGTTAAATGTTTTCGTTGGGCTAA
ATTTAGTTCAATACGCTCTTTAATAAAGTATAATTCT