Microarray Probes on PGSC0003DMT400060084

Probe IDChipProbe Sequence
CUST_14083_PI426222305 JHI_St_60k_v1 CAAAAGTGGCTGAAAAAGAAATGGCTATGGCTGCAAATTATGGAGGGCTACTTAAGAAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060084

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060084 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G39210.1 +1 0.0 783 387/560 (69%) Major facilitator superfamily protein | chr2:16366287-16368231 REVERSE LENGTH=601

Transcript Sequence (1749 bp)

>PGSC0003DMT400060084 1749 pgsc_dm_v3.4
ATGAAGAACCTAACACTACAAGTCCTAACAGGAAGATGGTTCATGGTATTTGCAACTGTT
CTAATCTTATCAGCCTCTGGTGCTACATACATTTTTGGTATATACTCAACTGATATCAAA
ATTTCGCTCGGATACGATCAAACCACCCTTAATTTACTTAGTTTCTTCAAAGATTTAGGT
GGAAATGTTGGTATCCTATCTGGTTTAATCAATGAAGTAACACCCCCTTGGGTTGTCCTT
TCATTTGGTGCTGTCCTTAACTTTTTTGGTTACTTCATGATTTGGCTTTCAGTGACTAAA
AAAATCCCAAAACCAAAAATTTGGCACATGTGTTTGTACATTTGTGTTGGTTCAAATTCT
CAATCTTTTGCTAACACTGGTGCATTAGTTACTTGTGTTAAAAACTTCCCTGAGAGTCGT
GGCGCGGTTCTTGGACTACTTAAGGGGTATGTTGGATTAAGTGGTGCAATGTTGACACAA
ATTTACCATGCTATATATGGTAATGACTCTAAGTCTCTTATTCTACTTATTGGTTGGCTT
CCTCCTGTTGTTTCATTGTTTTTCTTGCGTATAATTCGCGTTATGAAGGTGGTTAGAGTT
GAACATGAGATGAAGGTGTTTTATAAGTTTTTGTATACATCACTTGGACTAGCTGGATTT
CTCATGTTGGTTATTATACTTCAAAAAAAGATGCATTTTAAGCAAATTGAATATGGTTTA
AGCACTTCAATTGTTCTGTTTTTGCTCTGTTTGCCACTTGTTGTTGTTGTTAAAGAAGAA
TTTGATTCATGGAAAATCAAGAAACAAGAATTGGAAAGTGTATCACAAGTGAAATTAGTC
ACTGAGGTGCCAAATTGTGACATATCTCAACTTCAAATGGTGACACAAAGTGATGCAAAA
GATCAAGAAAATCGAAGTGAGATTCAAACTCAAGAACATATTTCTTGTTGGAGGACAGTT
TTTCGCGCACCAGATAGAGGTGAAGACTATACTATACTTCAAACTCTATTCAGTATTGAC
ATGTTGATACTATTTTTCGCGACAATTTGTGGCGTTGGAGGGACACTAACAGCAATAGAC
AACTTAGGACAGATAGGGACATCATTAGGCTATCCAAAAACAAGTATTAGTACATTTGTG
TCATTAGTTAGTATATGGAATTACTTAGGTAGAGTTGTGTCTGGCTTCTTGTCTGAGCAT
TTCTTGACCAAGTACAAATTTCCAAGGCCTCTTATGCTCACAATAACACTCGTGATCTCT
TGTTTAGGCCATCTTTTAATCGCGTTCAACGTGTCTGGGGGCCTATATGTTGCATCTATA
GTCATAGGATTTTGCTTTGGGGCACAATGGCCATTGTTATATGCCATAATATCAGAGTTA
TTTGGGTTGAAATATTACTCAACACTTTATAATTTTGGATCAGTAGCAAGTCCAATTGGT
GCATATTTGCTAAATGTGAGAGTTGTTGGCTATTTATATGATAAAGAGGCTAATAGACAA
ATAATGGCTATGGGAAAAATTAGGAAAATTGGTGAAGATTTGGAGTGTAATGGAGATGAA
TGTTTCAAATTAGCCTTTTTAATTATTACTGGTGTGACAATTCTAGGGGCATTTGTGTCA
ATTATTTTGGTATTAAGAACTAGGAAGTTTTATAAGAATGATATTTACAAGAAATTTAGA
GAGGAAGCAAAAGTGGCTGAAAAAGAAATGGCTATGGCTGCAAATTATGGAGGGCTACTT
AAGAAATAA