Microarray Probes on PGSC0003DMT400060014

Probe IDChipProbe Sequence
CUST_14246_PI426222305 JHI_St_60k_v1 CCCACATATTCGCATCAAGTAATAGGTCTTTCAACATTGGTTTTGGAATTCTTAGAAACT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400060014

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400060014 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G04350.1 +2 0.0 655 324/536 (60%) Plant protein of unknown function (DUF946) | chr3:1153972-1156469 REVERSE LENGTH=567

Transcript Sequence (3252 bp)

>PGSC0003DMT400060014 3252 pgsc_dm_v3.4
AATAACTCCTATATTTAATACAAAAAATTAGAGAAAATAGTGCTGTTTTTGTACTTGTCC
AAGTTTCTTGATTTCAAAGTATTTTTACTTTTCTAGTCAGCTTAAAAGCAAAATCTTGAT
TTTCTGTTTTCTTGATTTTTTTGTTAAAGAAGAAATGTTTGGGAGTGATTGTTGCTGTTG
GGACAGTTTCACTGATTACAACTATGATGAAATTGAACCACAGAGCTTTACTTTGCCTTC
ACCAATTCCACAATGGCCTCAAGGTATTTCTGTTTTTGTTTTTTTATGTTAAAGAGATAA
CACAAGATCTGTATTTTGTTCTCAGTGGACTTTGTCAGTTTAATTTGTTTTATGGTTGAC
TTGGTCTAAAAATGAATGTAATTATCTATTTGTTACTAAAGTTCACATTTTTATGCTAGT
TGAGAATATATTCTAGTATTTGTAATTTACCCCTTTTAAGCCGAGTGTCTATCAGAAACA
GTTTATCTCTAAGAGGAATAGGTAAGGTCTGTGTATAGTTACTCATCCCGGACTCCACTT
GTGAAATTAGACGGGATATGTAATTGTTGTTATAATTTAGTCTTGGGTTAATTTACAATG
AAAAATCATGACGTTCATATAGCTAACCCCAACTTATTTGAAATTGAGGCATTGTTGTTG
TAAAGTTCACATTCTTATGTGGAAAGAATATGTAGTTCAGTTGACTCTCTCTTTCTCTCT
CTCTCTGGTTGATTTGAGCTAAAAATGAAGAATTGATTTACTACGTCCGTTTCAATTTGA
CACGAAGTTTAAGAAAATAAATACTTGAGATTTTTGAGTTGTGTGGTCCTAAATTGAAGA
TATGTAGAATATACTATATTTACCTTGTGGTTTTATATATGTCATACAGAAAATTTTGAA
TTTTAGAGTTGCCAAAAACGGAAAGAGGTACTTTTTTTTAATGGACTGAAAATGAAAGTA
AGACAAACAAATTGAAACAGAAGGTGTATTTGTTAACGAAGTTCTCATTTTTATGCCAGT
AGAAAATCACTTCTAGTAGTAGTATTTTTACTTTGTATGATATTGGCTTGAGATAGTTTT
AAAGAGAAATATGATCGACGTGGGTTCATATAGCCAATCCAACTTGTTTGAGATTTAGGC
GTAGTTGTTGTAAAGTTCACATTTTCATGTGGCAATAATCTCTCTCAAGTGAACTCAGTG
AGTATTTATATGGCCGACCACATTGTATGTATCAAGCTATATTGCTCGAACTCTCAAAAA
ATTATTGCCACATTCGTCTGCAATTCTCAAAAAACGCACTACTTTCGGAGGATCCAACAT
GCACTTGTCCGCATAATTGAAGAGTCCGGGAAACATAGTAGGGATCAAGCATGATTTCTC
ATATTGTCTTTGTGTAGGTAAAGGATTTGCTCAAGGAAAAATTTGCCTAGGTGAAATTGA
AGCTGTTCAAATCACCAAGTTTAAGAAAATTTGGAGTTGTAGTCCATTGTTTGGCAAATC
AAAATCAGTTTCATTCTACAGGCCAGATGAAATTCCACAAGGATTTTCGATCGTTGGCCA
CTATTGTCAGCCAGATGGTGAGAAGAACATAACAGGCTATGTTCTTGCTGTCAAAGGTTT
GAAGCCGAAAAAATTACTTCAAGATGCAGCTTCCAAGCTTCCTGCTCTTGCAAAGCCAAT
GAACTACACTTTAGTTTATAACGCAAACACTCTTTATAAGGAAGTTGGTTACATTTGGCT
TCCAAATGCACCAGTTGGTTATAAAGCAATGGGCTTTGTGGCTACTGCTGAGCCTAATGA
ACCGAATCTTGATGAAGTTAGATGTGTCCGCGCTGATCTTACAGAGAGTTGTGAGACTTG
TGAAGTTGTTTTTAGTGCAAATTCATTTTTTGCAAAGAGGCAATTTCAAGTTTGGAAAAC
TAGACCTTGCAAGAGGGGCATGTTATGTAGAGGGGTTTCAGTCGGGACGTTCTTCTGCAG
TACGAGCTTCACTAAAGGCGATGAACTCACAGTTGCATGTTTGAAGAATTTCGACTCGTC
TCTACAGGCAATGCCTAATCTTGAGCAGGTCCATGCACTCATCAAGCACTATGGACCTAC
TGTTTACTTCCATCCTGATGAAATTTACTTGCCCTCATCCGTTCCATGGTTTTTCTCAAA
CGGAGCTCTTCTATTTAAAGATGGTAAGGACAATGGTATTGCTATTGACGCGAAAGGCTC
AAACTTGCCTGCAGGTGGACGAAATGATGGGAAATACTGGCTTGATTTGCCTAATAAAGA
TGTTGAAAATAGACAGACTGTGAAATGTGGTAAAATTGAGACCGCGGAGCTCTATGTTCA
TGTTAAACCGGCTGAAGGAGGAACGTTCACTGATATTGCAATGTGGATATTTTGCCCCTT
CAATGGACCAGCTACACTCAAAGTAGGCTTGATAAATCTTTCCCTGAATAAAGTAGGCGA
ACATGTTTGTGATTGGGAGCATTATACTCTTCGTATTAGCAACTTCTCAGGGGAGCTCTG
TAGTGTATACTTCTCAGAACATAGTGGTGGTGAATGGGTTGATGCTCGTGATTTGGAGTT
CATCGAGGGGAATAAGTCAGTCGTATATGCATCAAGAAATGGCCACGCGAGTTTCCCACA
TCCTGGATGTTACCTTCAAGGCAATACAAAACTTGGTATTGGAGCAAGAAATGATTGTGC
AAAAAGCAAATACTATGTAGACTCTAGCAGTAAGTATCGAATCATCGCTGCTGAGTATCT
TGGAGAAGGAACTGTGGTAGAACCGCCATGGTTACAATACATGAGGGAATGGGGTCCAAC
CATTGAGTACAAATCGGGTTATGAAGTGGACGACATAATCAAACACCTTCCATCTTTTTT
CAGATTTTCAGTGGAGACTCTCGTCGAGCTATTTCCAACTGAACTTTATGGTGAAGCAGG
GCCAACAGGACCTAAGGAGAAGAACAACTGGTTCGGGGATGAAAGGTGGTAAGACAGAGG
CGAATCCAGGATCCAAAGTCACTAAGTTCAAAATAAGTATGATCTTATTATACGTTTTTC
CTTTTTGTGCATATGTATACATGATTGATCCGAAAGCAATAGGTTCAGTTGAACCCACAT
ATTCGCATCAAGTAATAGGTCTTTCAACATTGGTTTTGGAATTCTTAGAAACTTGGATAT
ATGTATTATAAGTAAATGACTACAATATAGTGAAATTTGTTATATATATCCCAAAAAAGA
ATGACACAATTA