Microarray Probes on PGSC0003DMT400059948

Probe IDChipProbe Sequence
CUST_14276_PI426222305 JHI_St_60k_v1 AAACAATCACAACCATCATCACCACCAATATCTTTCTAGTTCTTTGTCTTTTCACTCATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059948

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400059948 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G53590.1 +1 1e-16 74 32/72 (44%) SAUR-like auxin-responsive protein family | chr5:21772107-21772535 FORWARD LENGTH=142

Transcript Sequence (577 bp)

>PGSC0003DMT400059948 577 pgsc_dm_v3.4
CACATATTCACCACTTATTAGACCTCATCACTTGTTCACAACACACATATTCTCCCTCTC
TTATCTTTTCTATTGCGATTAATTCTGCGATCAAACTTTTATTAATTTATATATTAATAT
CAAACGATAAAAATCATGAAGGTGAAGAAAGGATGGCTAGCAATTCAAGTAGGACTAGAA
GAAGAAGATGGTGGTATTCAAAAATTTGTTATCCCAATTTCATATCTATATCATCCTCTT
CTACAAAAGCTTCTTGATAAAGCTCATGATGTCTATGGCTACCATGTTGATGGACCATTA
AAGCTACCTTGCTCCGTCGACGACTTCCTCCATATAAGGTGGAGGATTGAGAAGGAGCCT
AATCGGAGCCACCATCACAAAAACAATCACAACCATCATCACCACCAATATCTTTCTAGT
TCTTTGTCTTTTCACTCATGTTAATTAAATTATAGTACTAAGGTTTCCTTGTAATTAAGG
TCTAATTTATTTTTTCTTGGGAAATTTTGACTTTTGTTATTGTACTATCTTGTTAAACAC
ATTTAGTTTTCAATTTATTGAAACAAGCACTTTTAAT